Labshake search
Citations for GenScript :
551 - 600 of 1186 citations for DNA Mismatch Repair Protein Msh3 MSH3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... GST-tagged NSUN2 proteins were purified by affinity chromatography using reduced glutathione resin (GenScript, L00206) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: Codon-optimized open reading frames for EuRe and BoMoC RT proteins were ordered from GenScript. Proteins were produced in Escherichia coli by expression from MacroLab vector 2bct with a C-terminal 6xHis tag (https://qb3.berkeley.edu/facility/qb3-macrolab/#facility-about ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV2 Spike protein (100 nM, S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ), EG00229 (Cat#6986 ...
-
bioRxiv - Microbiology 2020Quote: ... The expression of each anti-HIV-1 CAR was detected by protein L-biotin (GenScript) and Alexa488-conjugated anti-human Fc antibody or APC-conjugated anti-human Fc antibody as described elsewhere [78] ...
-
bioRxiv - Biochemistry 2021Quote: ... 15 μg total protein was loaded and resolved on Bis-Tris 4-12% gels (GenScript) and transferred to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Immunology 2022Quote: ... vaccines consisted of either SARS-CoV-2 Spike RBD WH-01 protein (GenScript; cat# Z03483) or SARS-CoV-2 WH-01 Spike protein (Acro Biosystems ...
-
bioRxiv - Microbiology 2021Quote: Microtiter plates (96-well; Thermo) were coated with 1 μg/mL S-2P protein (Genscript) corresponding to the S protein of the Wuhan-Hu-1 virus ...
-
bioRxiv - Molecular Biology 2021Quote: ... the supernatant containing the target proteins was loaded onto anti-FLAG G1 affinity resin (Genscript). The resin was washed using buffer A (20 mM Tris ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were incubated with Spike-RBD protein (5 μg/mL, Genscript, Z03483) in adherent buffer (1mM CaCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... The SECphi4 56aa protein of unknown function was the only gene not synthesized by Genscript Corp ...
-
bioRxiv - Plant Biology 2022Quote: ... samples were run on a 4%-20% gradient protein gels (GenScript, SurePAGE, Cat. No. M00655) and stained with Fast Silver Stain Kit (Beyotime ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids expressing the PABPN1- Flag (NM_004643) and THOC5-HA (NM_001002878.1) proteins were purchased from GenScript. Plasmid pcDNA-THOC1-HA was generated by cloning the THOC1 sequence from plasmid phHpr1-GST (Addgene #11200 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The expression of the CAR was detected using a biotinylated protein L (GenScript, Piscataway, NJ) antibody and streptavidin-coupled PE (BD Biosciences ...
-
bioRxiv - Bioengineering 2024Quote: PEG hydrogels were functionalized with the following peptides and proteins purchased from Genscript (Piscataway, NJ): RGDS ...
-
bioRxiv - Molecular Biology 2023Quote: ... whereas all other gels were stained using the eStain™ L1 protein staining system (GenScript). Precision Plus Protein™ standards (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of protein lysates were loaded onto SurePAGE Bis-Tris 4-20% gels (Genscript) and transferred either to
-
bioRxiv - Genetics 2023Quote: ... The protein samples were separated by SDS-PAGE (4-12% Bis-Tris gels, Genscript, #M41210C) with MOPS buffer (Tris-MOPS-SDS Running Buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein coding sequences for PRMT1v1 (ENST00000391851.8) and PRMT1v2 (ENST00000454376.7) were ordered from GenScript (https://www.genscript.com) and PCR-cloned into pHIV-Luc-ZsGreen (Addgene plasmid #39196 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total cellular proteins were separated in 4-12% YoungPAGE Bis-Tris gels (GenScript, Nanjing, China) or 10% gels using One-Step PAGE Gel Fast Preparation Kit (Vazyme) ...
-
bioRxiv - Microbiology 2024Quote: ... the enriched proteins were separated on a gradient gel (GenScript, 4–20% precast polyacrylamide gel) at 120V for 5∼10 min ...
-
bioRxiv - Microbiology 2024Quote: The total natural IgG was purified from murine serum using Protein G resin (GenScript, China) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... enterica Tsr LBD construct for recombinant protein expression was performed as a service by Genscript Biotech Corp ...
-
bioRxiv - Microbiology 2024Quote: ... whereas the His-tagged proteins were purified using Ni-NTA affinity chromatography media (GenScript, L00250). The specified amounts of GST or GST-MGF_360-4L were incubated with glutathione resin at room temperature for 3 hours ...
-
bioRxiv - Biochemistry 2024Quote: ... LPS content of the recombinant proteins was assessed via the LAL method (GenScript ToxinSensor L000350). Samples were approved for cell and animal use when they contained < 4 EU LPS/mg protein.
-
bioRxiv - Microbiology 2022Quote: ... Heterologous expression was detected by electroblotting SDS-PAGE Tris-glycine gels onto nitrocellulose membranes and immunostaining with primary rabbit anti-His-tag antibody and secondary goat anti-rabbit IgG phosphatase alkaline conjugated antibody (GenScript, Piscataway, NJ, USA) (Suppl ...
-
bioRxiv - Immunology 2023Quote: ... a biotinylated rat polyclonal antibody against human Fc was used as a capture antibody and anti-human IgG Fc-HRP (GenScript Cat# A01854-200) as a detection antibody ...
-
bioRxiv - Biophysics 2024Quote: The S-S309 antigen-antibody antibody complexes were electrophoresed on the 4-12% SurePAGE™ Bis-Tris gel (Genscript Biotech Corporation, Jiangsu, China). The proteins were visualized by One-Step Blue Stain (Biotium ...
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Microbiology 2022Quote: ... The specific cyp51A promoter mutations were synthesized as DNA fragments and obtained from GenScript USA Inc ...
-
bioRxiv - Biochemistry 2022Quote: ... the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC ...
-
bioRxiv - Biochemistry 2023Quote: DNA encoding PEDV and SARS-CoV-2 nsps were codon optimized and synthesized (Genscript). PEDV protein sequences correspond to GenBank AKJ21892.1 ...
-
bioRxiv - Plant Biology 2024Quote: ... and vsfGFP-0 components were synthesised (Integrated DNA Technologies; IDT, Singapore or Genscript, China). Importantly ...
-
bioRxiv - Bioengineering 2024Quote: In-vitro transcription (IVT) was performed to synthesize mRNA from template plasmid DNA (GenScript) that had been linearized using the BspQI enzyme ...
-
bioRxiv - Bioengineering 2024Quote: In-vitro transcription (IVT) was performed to synthesize mRNA from template plasmid DNA (GenScript) that had been linearized using the BspQI enzyme ...
-
bioRxiv - Biochemistry 2023Quote: ... the expression levels of each mutant series and their wild-type version were normalized for comparison purposes by quantitation via western blots against the 6xHis tags present at the C-termini of all constructs (Antibody: anti-His-Tag Antibody coupled with iFlour 488, Genscript, A01800, 1:500 dilution). Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Developmental Biology 2020Quote: ... custom made rabbit anti-chick MMP13 antibody (1μg/ml, Genscript), rabbit anti-CXCL14 (0.2 μg/ml ...
-
bioRxiv - Immunology 2022Quote: ... Horseradish peroxidase labeled mouse anti-His tag antibody (GenScript: A00186) was added for 30 minutes at 1:1000 dilution ...
-
bioRxiv - Biochemistry 2022Quote: ... 1:1000 anti-His HRP antibody (GenScript, A00612, Lot. 19K001984), 1:1000 anti-HA-Tag (C29F4 ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for GAPDH and actin were obtained from Cell Signalling.
-
bioRxiv - Microbiology 2021Quote: ... Polyclonal antibodies against OVA or SV40 were obtained from GenScript (GenScript ...
-
bioRxiv - Microbiology 2022Quote: ... in-house custom rabbit anti-RVFV nucleoprotein polyclonal antibody (Genscript) and anti-pan cytokeratin typeI/II anti-cytokeratin polyclonal antibody (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... labeling with 1:200 biotinylated anti-Strep tag antibody (GenScript) was followed by 1:500 BrilliantViolet 421 conjugated with Streptavidin (Biolegend) ...
-
bioRxiv - Microbiology 2022Quote: ... Mouse Anti-Rabbit IgG Fr secondary antibody (GenScript, Piscataway, NJ) 1:30,000 was used for assays of these rabbit-derived samples ...
-
bioRxiv - Microbiology 2021Quote: ... for SyNOS and a specific OtNOS antibody generated by GenScript Company.
-
bioRxiv - Neuroscience 2021Quote: We used the following primary antibodies: NEEP21/NSG1 (Genscript A01442), FAM21 (Millipore ABT79) ...
-
Metal transporter SLC39A14/ZIP14 modulates regulation between the gut microbiome and host metabolismbioRxiv - Physiology 2021Quote: ... Rabbit anti-mouse ZIP14 antibody was custom made by Genscript. Antibodies for ZIP4 ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit anti-PknG antibody was produced and purified by GenScript Biotechnology with the recombinant GST-tagged PknG protein as immunogen (1/10000 for immunoblotting ...
-
bioRxiv - Microbiology 2020Quote: ... A human chimeric anti-S1 antibody (Genscript; 1:200 dilution) followed by an Alexa647-conjugated goat anti-human IgG (Jackson Laboratories ...
-
bioRxiv - Microbiology 2020Quote: A custom polyclonal anti-KH antibody was generated by GenScript, using their 49-day antibody generation protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and polyclonal αcGAS antibodies were purified by antigen affinity (GenScript). Serum was used at 1:30,000 for cGAS detection ...