Labshake search
Citations for GenScript :
501 - 550 of 1186 citations for DNA Mismatch Repair Protein Msh3 MSH3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Protein samples were electroporated on 4-20% gradient SurePAGE™ Bis-Tris gel (Genscript) or 4-20% Tris-glycine gel (BioRad ...
-
bioRxiv - Biochemistry 2024Quote: Protein samples were resolved on precast SurePAGE Bis-Tris 4-20% gradient gels (GenScript) or 16% Tris-Glycine gels (Invitrogen ...
-
bioRxiv - Biophysics 2024Quote: ... coli codon-optimized gene of the full-length protein L3P mutant purchased from GenScript, using the primers in Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2024Quote: ... equal amounts of protein samples were loaded and separated on 10% SDS gels (GenScript). Subsequently ...
-
bioRxiv - Developmental Biology 2024Quote: ... Approximately 1.5 mg of Mlβ-cat protein collected via PreScission Protease (GenScript cat.# Z02799) digest and 6 mg of Mlβ-cat-GST protein collected via 10 mM glutathione whole protein elution were sent to Labcorp Early Development Laboratories Inc ...
-
bioRxiv - Synthetic Biology 2021Quote: ... research grade long single-stranded DNA was manufactured at large scale by Genscript Biotech via a proprietary isothermal enzymatic reaction process (PCT/CN2019/128948) ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA from the HEK293 cell line was purchased from GenScript (https://www.genscript.com).xs
-
bioRxiv - Plant Biology 2021Quote: ... The DNA sequences of the single aMIRNA genes were chemically synthesized by GenScript® (GenParts™ Synthesis service ...
-
bioRxiv - Bioengineering 2022Quote: ... GeneArt and GC3 luciferase variants were ordered as separate GenParts DNA fragments (Genscript). The GC3-optimized NPC1 sequence was encoded in a plasmid (Twist Bioscience ...
-
bioRxiv - Synthetic Biology 2022Quote: ... gRNAs and related sequences were commercially synthesized (Integrated DNA Technologies IDT and GenScript) and then cloned into corresponding entry vectors using In-Fusion cloning (Takara Bio ...
-
bioRxiv - Immunology 2020Quote: DNA encoding SARS-Cov-2 RBD (residues 319-541) was gene synthesized (Genscript) and cloned into pCEP4 mammalian expression vector with a N-terminal IgG leader sequence and C-terminal Avitag and His tag ...
-
bioRxiv - Immunology 2020Quote: ... DNA encoding the SARS-Cov-2 RBD (residues 331-527) was synthesized (Genscript) with a C-terminal His6 purification tag and cloned into a CMVR plasmid ...
-
bioRxiv - Genetics 2022Quote: ... DNA plasmids co-express variant and WT KCNH2 allele were ordered from GenScript Inc (Pistcataway ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The pheS* DNA sequence was obtained by gene synthesis (service provided by GenScript).
-
bioRxiv - Cell Biology 2024Quote: ... Codon-optimized anti-cMPL scFV DNA was synthesized by GenScript (Piscataway, NJ, USA). DT390-biscFV(cMPL ...
-
bioRxiv - Immunology 2022Quote: DNA encoding SARS-Cov-2 RBD (residues 319-541) was gene synthesized (Genscript) and cloned into the pCEP4 mammalian expression vector (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... FRET-labeled 207 bp DNA was prepared by PCR using labeled primers (GenScript) ATCGGACCC/iCy5N/ATACGCGGCC (forward primer) ...
-
bioRxiv - Biochemistry 2023Quote: The DNA coding for the LRRK2 residues 1327 to 2527 (OHu107800 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGAAAAAGGCTGTGCCTTATAACCGA and the reverse primer TATCCACCTTTACTGCTCTCAACAGATGTTCGTCTCATTTTTTCA ...
-
bioRxiv - Molecular Biology 2024Quote: ... a synthetic DNA template was synthesized and cloned into pUC57 vector by Genscript Biotech Corp ...
-
bioRxiv - Biochemistry 2024Quote: ... TCR and CD3 chain DNA constructs were codon-optimized and synthesized by GenScript. The full-length G115 and 9C2 TCR constructs were comprised of the δ-chain followed by the γ-chain with an intervening furin cleavage sequence and a P2A cleavage site ...
-
bioRxiv - Biochemistry 2022Quote: ... PVDF membranes were cut and immunoblotted with α-TatA and α-TatB antibodies respectively followed by HRP-conjugated α-rabbit antibody (GenScript). Proteins were visualized using ProSignal Pico ECL Western Blotting detection kit (Genesee Scientific).
-
bioRxiv - Plant Biology 2020Quote: ... and detected with anti-Myc antibodies (Genscript, #A00704 www.genscript.com) and ECL Plus chemiluminescent substrate (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2021Quote: ... a 1:200 biotinylated anti-Strep tag antibody (GenScript) treatment was followed by a 1:400 Streptavidin-BrilliantViolet 421 conjugate (Biolegend) ...
-
bioRxiv - Bioengineering 2022Quote: ... An HRP-conjugated anti-camelid VHH antibody cocktail (Genscript) was diluted 50,000-fold in block and 100 μL/well was added to the ELISA plates for 50 minutes with shaking ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were stained with mouse anti-HA antibody (Genscript) diluted 1:500 in PBS supplemented with 0.5% goat serum and 0.01% Tween-20 (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... Flag-tag specific mouse antibody (Genscript, catalog no: A100187) and HA-tag specific rabbit antibody (Cell Signaling ...
-
bioRxiv - Microbiology 2020Quote: ... and probed with a custom anti-NifD antibody (GenScript) overnight ...
-
bioRxiv - Microbiology 2020Quote: ... Primary polyclonal antibodies for Cfp29 were generated by GenScript USA Inc via immunization of rabbits with three peptides from the protein sequence ...
-
bioRxiv - Microbiology 2020Quote: ... and anti-HA goat polyclonal antibody (GenScript, A00168-40). The secondary antibodies ...
-
bioRxiv - Microbiology 2020Quote: The anti-LmrC(2) antibody was generated by GenScript USA Inc ...
-
bioRxiv - Microbiology 2021Quote: ... and monoclonal antibody (clone ID: 6D11F2) were from GenScript® ...
-
bioRxiv - Plant Biology 2022Quote: ... using anti-StTGA2.1 antibodies (diluted 1:4.000, GenScript, USA). Additionally ...
-
bioRxiv - Molecular Biology 2022Quote: ... MonoRabTM HRP Rabbit anti-Camelid VHH antibody (GenScript #A01861) was used to detect vhhGFP fusion proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... A custom RHINO polyclonal antibody was outsourced from GenScript using the recombinant protein described in the “Protein purification section” with 6xHIS tag retained and produced in rabbit (GenScript ...
-
bioRxiv - Plant Biology 2023Quote: Rabbit polyclonal antibodies were obtained from GenScript (NJ, USA). Epitopes were chosen based on the manufacturer’s prediction algorithm results in regions that were covered by the protein sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... Antibodies were custom-made by GenScript (New Jersey, USA), using the sequences provided in the Supplementary source data.
-
bioRxiv - Microbiology 2024Quote: ... A custom primary antibody for Imp1 (α-Imp1, Genscript), a commercial primary FLAG antibody (α-FLAG ...
-
bioRxiv - Genomics 2024Quote: ... The polyclonal antibody was purified by affinity column (GenScript). No cross reactivity against the host cell lysates was seen by western blots (Supplementary figure 13B) ...
-
bioRxiv - Microbiology 2024Quote: ... and incubated with a α-HIS antibody (Genscript A00186), followed by HRP-conjugated α-mouse antibody (Abclonal AS003) ...
-
bioRxiv - Biochemistry 2024Quote: ... anti-Strep-tag antibody (Genscript #A01732, ; 1:2,000 dilution), anti-FLAG-tag antibody (Sigma #F1804 ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit immunization and antibody purification were conducted by Genscript Co ...
-
bioRxiv - Immunology 2023Quote: ... with MonoRab™ Rabbit Anti-Camelid VHH Antibody (GenScript) diluted 1:250 in coating buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... using the High-Affinity Antibody Purification Kit (L00404, GenScript) following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... anti-FLAG antibody conjugated to iFluor 488 (GenScript A01809) at 1:2,000 dilution ...
-
bioRxiv - Developmental Biology 2023Quote: The guinea pig Zfh1 antibody was generated by GenScript. Recombinant antigen consisting of amino acids 648-775 of Zfh1 isoform PB was produced with an N-terminal His-tag used for purification ...
-
bioRxiv - Microbiology 2024Quote: ... A rabbit IgG anti-Avi polyclonal antibody from Genscript was used at a dilution of 1:3000 in combination with a goat anti-Rabbit IgG-HRP monoclonal antibody at 1:2000 ...
-
bioRxiv - Microbiology 2024Quote: ... and incubated with mouse α-HIS antibody (Genscript A00186). Proteins were detected using HRP-conjugated goat α-mouse antibody (Abclonal AS003) ...
-
bioRxiv - Microbiology 2024Quote: The recombinant antibody development workflow was conducted by Genscript Biotech (Piscataway ...
-
bioRxiv - Biochemistry 2024Quote: ... CBP (Mouse; GenScript CBP Tag Antibody cat. No. A01798), Rpt1 (Abcam Aβ22678) ...
-
bioRxiv - Biophysics 2020Quote: The cDNA sequences for the protein variants used in the study were purchased from GenScript and the proteins were N-terminally tagged with a 6xHis-Lipo domain ...