Labshake search
Citations for GenScript :
451 - 500 of 1186 citations for DNA Mismatch Repair Protein Msh3 MSH3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Gp120 DNA was synthesized and cloned into a pVax expression plasmid (Genscript). The proteins were produced by transfection of 293F cell cultures in Expi293 expression media (ThermoFisher ...
-
bioRxiv - Biochemistry 2024Quote: ... Codon-optimized R2 ORFs and other DNA modules were purchased from GenScript. R2 ORFs were cloned into a pET45b vector with N-terminal His14-MBP-bdSUMO tags and C-terminal TwinStrep for bacterial expression (Addgene vector #176534) ...
-
bioRxiv - Developmental Biology 2021Quote: Polyclonal antibodies were generated by Genscript (https://www.genscript.com/). The epitopes used for each immunization are listed below.
-
bioRxiv - Developmental Biology 2021Quote: Anti-ApoB-1 antibodies were generated by GenScript USA (Piscataway ...
-
bioRxiv - Immunology 2021Quote: Generation of antibody expression vectors was outsourced (Genscript). The Ig VH and VL sequences were cloned into a pcDNA3.4 expression vector containing human IgG1 constant regions ...
-
bioRxiv - Bioengineering 2020Quote: ... HRP-conjugated secondary antibodies against His-tag (Genscript) were diluted 1:5,000-10,000 and incubated with the well for 1 hr at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Genes of bispecific antibodies were synthesized by Genscript. The authentic Omicron (B.1.1.529 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse anti-Tubulin antibody (1:10000, A01410, GenScript), rabbit anti-LaminB1 (1:5000 ...
-
bioRxiv - Microbiology 2020Quote: ... Mouse α-His antibody (1:1000, Genscript A00186) in TBST buffer with 0.5% BSA and goat α-mouse IgG (H+L ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... rabbit anti-p65me2 (customized antibody, Genscript, Piscataway, NJ), mouse anti-FLAG M2 (at 1:3,000 dilution ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... or rabbit anti-myc tag antibodies (GenScript; A00172).
-
bioRxiv - Developmental Biology 2021Quote: ... The polyclonal NvINSM1 antibody was raised by GenScript in rabbit against amino acids 3 – 170 of NvINSM1 expressed in and purified from E.coli ...
-
bioRxiv - Biochemistry 2021Quote: Polyclonal antibodies against PTP7 were generated by Genscript. Briefly ...
-
bioRxiv - Microbiology 2020Quote: Recombinant antibodies were cloned and produced by Genscript. Specifically ...
-
bioRxiv - Microbiology 2021Quote: ... neutralizing monoclonal antibody (GenScript®, clone ID: 6D11F2) was also used ...
-
bioRxiv - Immunology 2020Quote: ... or corresponding species-appropriate IgG control antibody (GenScript), conjugated to Protein A Dynabeads (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant antibody was cloned and produced by Genscript. Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... THE V5 Tag Antibody (1:2000, GenScript Biotech) was used as primary antibody for samples and mouse anti-clathrin heavy chain clone 23 (1:2,000 ...
-
bioRxiv - Plant Biology 2022Quote: ... specific rabbit His-tag antibody (GenScript, A00174-40) or anti-monoubiquityl-histone H2B (Lys-120 ...
-
bioRxiv - Plant Biology 2024Quote: ... Primary antibodies used included anti-myc (A00704, GenScript), anti-RFP (YH80520 ...
-
bioRxiv - Biochemistry 2022Quote: ... and mouse anti-HA-tag monoclonal antibody (GenScript). After primary antibody incubation ...
-
bioRxiv - Developmental Biology 2023Quote: Polyclonal antibodies were generated by Genscript (https://www.genscript.com/). The protein sequences used for each immunization were as follows ...
-
bioRxiv - Developmental Biology 2022Quote: ... immunization and antibody purification were performed by Genscript Biotech Corporation (Piscataway ...
-
bioRxiv - Bioengineering 2023Quote: ... GenCRISPRLL SaCas9 Antibody 26H10 (GenScript, #A01952, Piscataway, NJ), and Anti-Adeno-associated Virus 9 Antibody clone HL2374 (Millipore Sigma ...
-
bioRxiv - Plant Biology 2023Quote: ... or a polyclonal anti-GFP antibody (GenScript, USA).
-
bioRxiv - Plant Biology 2023Quote: ... or a polyclonal anti-GFP antibody (GenScript, USA).
-
bioRxiv - Plant Biology 2024Quote: ... DM3 antibody from mouse was generated by Genscript using peptide CAKKEDWPPLYDVPR ...
-
bioRxiv - Developmental Biology 2024Quote: Rabbit anti-GFP poly clonal antibody (GenScript A01388) Dilution 1:500 anti-Fibrillarin(38F3 ...
-
bioRxiv - Microbiology 2022Quote: ... The primary antibodies include anti-229E nucleocapsid mouse monoclonal (Eurofins Ingenasa, Spain) and anti-229E spike rabbit polyclonal antibodies (Genscript, USA).
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then incubated overnight at 4 °C with primary antibodies at 1:100 dilution in PBST and 1 % BSA [SARS-COV-2 Spike S1 antibody (#HC2001 GenScript - #A02038), p62 antibody (#BD 610832) ...
-
bioRxiv - Microbiology 2024Quote: ... the membranes were incubated with an anti-Strep tag II antibody (THE™ NWSHPQFEK Tag Antibody, GenScript, USA, 1:1000 dilution) to detect Strep-tagged nsp1 and with an anti-GAPDH mouse-antibody (1:1000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... 293T cells were transiently transfected with plasmids expressing SARS-CoV-2 spike protein (GenScript MC_0101081 ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 Spike protein (S1 domain aa16-685, Cat# Z03485, Genscript, Piscataway, NJ) was added at concentrations ranging from 0.07 to 500 to nM ...
-
bioRxiv - Immunology 2020Quote: Plasmids encoding cDNAs for hMPV F proteins listed in Table S1 were synthesized (GenScript) and cloned into the pcDNA3.1+ vector ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 μg protein from each sample was mixed with LDS Sample Buffer (M00676, GenScript) and loaded in each well of a 4-20% SurePAGE™ Bis-Tris gel (M00656 ...
-
bioRxiv - Bioengineering 2022Quote: We obtained the genes encoding the designed proteins in pET28a vectors from GenScript (Genscript.com). We confirmed the sequences of all the constructs by DNA sequencing (Eton bioscience ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Bipartite proteins were detected using the rabbit anti-mCherry (A00682, GenScript, 1:3000 diluted), the mouse anti-His (A00186 ...
-
bioRxiv - Microbiology 2021Quote: ... All the proteins were endotoxin free (ToxinEraserTM Endotoxin Removal Kit, GenScript Biotechnology, Nanjing, China).
-
bioRxiv - Microbiology 2022Quote: ... 10^5 splenocytes were seeded and stimulated with peptides against S protein (From GenScript) (2μg/ml ...
-
bioRxiv - Microbiology 2021Quote: ... gene segment containing spike protein of SARS-CoV-2 wa s synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2020Quote: Mouse mAb 10G6H5 against SARS-COV2 S protein was purchased from GenScript (Piscataway, NJ). Rabbit antisera against the S1 subunit ...
-
bioRxiv - Immunology 2020Quote: ... ELISA plates were coated with 200 ng/well CoV2 RBD protein (GenScript; Cat: Z03483) overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... fumigatus-optimized fluorescent protein mNeonGreen by using vector pSR25 (synthesized by GenScript, Piscataway, NJ). Primer pairs AtrR-CoNG MH F (CCCGGTCTTCGACACCA ATGGTCCACCCCACGGTGGATTGGCTGGTGCCGGTGCTGGT ...
-
bioRxiv - Biophysics 2022Quote: ... The fusion protein MBP-Q44-HttEx1 was subcloned into a pMalc2x plasmid by Genscript. The protein expression was done in Escherichia coli BL21(DE3 ...
-
bioRxiv - Biochemistry 2024Quote: ... Digested product was bound to 500 µL of protein A resin beads (GenScript #L00210) overnight at 4℃ on a rotating shaker ...
-
bioRxiv - Microbiology 2024Quote: ... and synthetic fragments and genes encoding the fluorescent proteins from Genscript (Supplementary Table 2).
-
bioRxiv - Microbiology 2023Quote: Full-length wMel WalE1 and wAna FtsZ protein-encoding constructs were synthesized by GenScript using codons optimized for E ...
-
bioRxiv - Cell Biology 2023Quote: ... DCP-Bio1-bound proteins were pulled down with Streptavidin-coated magnetic beads (Genscript #L00936) overnight at 4 °C following manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... MgR protein was purified by passing through a column Nickle resin (GenScript Biotech Co.) and washed by using 3 column volumes of wash buffer (50 mM Tris-HCl at pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: The full recombinant MPL36 protein (rMPL36/aa 41-321) was commercially produced by GenScript® Biotech with His-tag in an E ...