Labshake search
Citations for GenScript :
5251 - 5300 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... cloned into pUC57 (Genscript, Piscataway, NJ) and amplified with primers CD2v-Fw (EcoRI ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... and Flag (A00187; Genscript) antibodies overnight at 4° C ...
-
African Swine Fever Virus CD2v protein promotes β-Interferon expression and apoptosis in swine cellsbioRxiv - Microbiology 2020Quote: ... control Flag (A00187; Genscript) and total NF-κB (8242 ...
-
bioRxiv - Microbiology 2020Quote: ... Fragment 4 was ordered as synthetic sequence (GenScript) with the first 274 bp recodonised and was amplified from plasmid pUC57-re-ap2-hc-1 using primers ap2-hc-5'_HR2_re_F and ap2-hc-5'_HR2_re_R.
-
bioRxiv - Microbiology 2020Quote: ... a synthetic DNA sequence (GenScript), corresponding to the pfap2-hc coding sequence +3528 to +4125 with the intron removed and the sequence +3954 to +4125 recodonised (plasmid pUC57-re-ap2-hc-2) ...
-
bioRxiv - Microbiology 2020Quote: ... burgdorferi dksA was commercially synthesized (GenScript, Piscataway, NJ, United States). The dksA gene was PCR amplified using primers listed in supplemental table 1 and cloned into the NheI site of the pMAL-C5X plasmid expression vector using a Gibson assembly kit (New England Biosciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... MIR200 CRISPR V2 was custom-made and purchased from Genscript (sequence of the gRNA is TGGGAGTCTCTAATACTGCC) ...
-
bioRxiv - Molecular Biology 2020Quote: ... pCDNA3.1(+)-Hygro plasmids and empty vector control were purchased from Genscript and transfected with PEI ...
-
bioRxiv - Microbiology 2020Quote: ... The human ACE2 (residue 19-615, GenBank: NM_021804.2) was synthesized by Genscript and cloned into VRC8400 with a N-terminal Kozak consensus sequence and signal peptide and with a C-terminal octa-histidine tag.
-
bioRxiv - Microbiology 2020Quote: The IgG heavy and light chain variable genes of CB6 mAb (GenBank: MT470196 and MT470197) were human codon-optimized and synthesized by Genscript and cloned into antibody expression vectors.
-
bioRxiv - Microbiology 2020Quote: ... coli codon-optimized and synthesized by Genscript and cloned into a modified pET28a* vector with a N-terminal hexahistidine tag ...
-
bioRxiv - Microbiology 2020Quote: ... The remnant endotoxin was identified with ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit (Genscript) and no more than 0.1 EU/mL of endotoxin was detected.
-
bioRxiv - Microbiology 2020Quote: Endotoxin of all purified proteins was removed with ToxinEraserTM Endotoxin Removal Kit (Genscript) in accordance to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... by Genscript.
-
bioRxiv - Microbiology 2020Quote: ... GenBank: MN908947) construct for preparation of RBD-based nanoparticle vaccine were human codon-optimized and synthesized by Genscript, and further cloned into mammalian expression vector VRC8400 with a N-terminal Kozak consensus sequence ...
-
bioRxiv - Microbiology 2020Quote: ... centrifuged and purified by affinity chromatography with protein A resin (Genscript), and subjected to desalt in a composed buffer 50 mM NaPO4 ...
-
bioRxiv - Microbiology 2020Quote: The I53-50B.4PT1 was codon-optimized and synthesized and then cloned into a modified pET28a* vector with a C-terminal hexahistidine tag by Genscript.
-
bioRxiv - Molecular Biology 2020Quote: LwaCas13a was purified by Genscript. For the EBOV and LASV-IV assays ...
-
bioRxiv - Microbiology 2020Quote: All sequences in this study were synthesized by Genscript and constructed into pMAL-c5x vector with N-MBP and C-6X His tags ...
-
bioRxiv - Molecular Biology 2020Quote: ... The LRFN2 peptides were purchased from Genscript (USA) and ITC experiments were performed on a MicroCal iTC200 instrument in ITC buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sequences representing the two DGAT1 isoforms were synthesised and cloned into pcDNA3.1 by GenScript (New Jersey, USA). Co-transfection of cells with pMAXGFP plasmid (Lonza ...
-
bioRxiv - Molecular Biology 2020Quote: ... A version of the LdNT3 stem-loop was synthesized with flanking BstXI and PCR primer binding sites (Genscript, Piscataway, NJ) and inserted into the BstXI sites of the modified pRP vector.
-
bioRxiv - Neuroscience 2020Quote: ... and equal amounts of protein were separated on a 4-12% SDS-gel (Genscript SurePAGE™). Proteins were transferred onto a PVDF Immobilon-P (0.45 µm Millipore) ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-CCHa1 (Our lab raised antibodies against the peptide QIDADNENYSGYELT 68, Genscript, 1:50 dilution). Secondary antibodies used ...
-
A gut-secreted peptide controls arousability through modulation of dopaminergic neurons in the brainbioRxiv - Neuroscience 2020Quote: Rabbit anti-CCHa1 antibodies were raised against the peptide QIDADNENYSGYELT21 by Genscript and affinity purified by the company.
-
bioRxiv - Biophysics 2020Quote: ... The corresponding gene is synthesized by Genscript, USA and cloned into pET28a(+ ...
-
bioRxiv - Biophysics 2020Quote: SARS CoV-2 main protease (Mpro or 3CL) gene from strain BetaCoV/Wuhan/WIV04/2019 was ordered from GenScript (Piscataway, NJ) in the pET29a(+ ...
-
bioRxiv - Biophysics 2020Quote: ... SARS CoV-2 papain-like protease (PLpro) gene (ORF 1ab 1564 to 1876) from strain BetaCoV/Wuhan/WIV04/2019 was ordered from GenScript (Piscataway, NJ) in the pET28b(+ ...
-
bioRxiv - Systems Biology 2020Quote: Clones were either collected from the human Orfeome 3.1 and 8.1 clone libraries (full length clones) or ordered as synthetic genes from Genscript (RBP constructs). As in our previous work (Jolma et al ...
-
bioRxiv - Biophysics 2020Quote: ... After the dialysis step we applied 1:100 stoichiometric molar ratio 3C protease (PreScission protease, GenScript, USA) to cleave the C-terminal hexa-histidine tag of construct-1 with native N- & C-terminals ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRAS and NRAS gene sequences (residues 1–166, with an N-terminal His-tag and C-terminal BAP-tag were synthesized by GenScript (Piscataway, USA) and cloned into pET11a ...
-
bioRxiv - Molecular Biology 2020Quote: ... AGO1/2 and AGO1/2/3 knockout cell lines used for RNAseq were prepared using GenCRISPR™ gene editing technology and services (GenScript) and verified HCT116 cells (Horizon Discovery) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pCCL-WSB1 and pCCL-c-Myc plasmids were purchased from Genscript, and were re-constructed to pCDH vector with N-terminal FLAG tag ...
-
bioRxiv - Cell Biology 2020Quote: ... laevis γ-tubulin (Genscript) for 2 hours on gentle rotisserie ...
-
bioRxiv - Cell Biology 2020Quote: ... synthesized (Genscript), and further cloned into pFastBac1 vector ...
-
bioRxiv - Immunology 2020Quote: ... DNA encoding the S protein ectodomains (residues 1-1194) from bat SARS-related CoV isolates Rs4231 and Rs4874 (ref.(Hu et al., 2017)) were synthesized (Genscript) with a C-terminal T4-Foldon domain or C-terminal GCN domain ...
-
bioRxiv - Immunology 2020Quote: ... DNA encoding the SARS-Cov-2 RBD (residues 331-527) was synthesized (Genscript) with a C-terminal His6 purification tag and cloned into a CMVR plasmid ...
-
bioRxiv - Immunology 2020Quote: ... These sequences were synthesized (Genscript) and cloned into CMVR expression vectors (NIH AIDS reagent program ...
-
bioRxiv - Immunology 2020Quote: ... cells were cultured in the presence of LCMV GP33-41 peptide (GenScript) and Protein Transport Inhibitor Cocktail (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti–β-actin (A00702, Genscript), or mouse anti-calnexin antibody (2433S ...
-
bioRxiv - Cell Biology 2020Quote: ... coli optimal codons and cloned into pUC57 by GenScript USA, ...
-
bioRxiv - Neuroscience 2020Quote: ... Nav1.2 and Nav1.6 were designed in-house and purchased from Genscript (Piscataway, NJ). cDNA constructs for wildtype Nav1.1 ...
-
bioRxiv - Microbiology 2020Quote: ... the cDNA for PbChiB2 (Fig. S1) and PbChiB4 (Fig. S1) without the signal peptide was synthesized and cloned into plasmid pET-14b (GenScript, USA). Plasmids were used to transform E ...
-
bioRxiv - Microbiology 2020Quote: The fragments encoding the P65 and P38 alleles genes were obtained from GenScript and cloned into pcDNA3.1 (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... it was synthesised (Genscript Corporation, Piscataway, NJ, U.S.A.) with optimum codon usage for expression in E ...
-
bioRxiv - Microbiology 2020Quote: ... LLO or AR purified by Ni-NTA (GenScript Biotech Co., China) procedure was eluted using imidazole buffers (pH 8.0 ...
-
bioRxiv - Microbiology 2020Quote: The anti-LmrC(2) antibody was generated by GenScript USA Inc ...
-
bioRxiv - Microbiology 2020Quote: A codon optimized MV-H gene (Edmonston B strain) was gene synthesized by GenScript. PCR amplification of the coding region of MV-H from the plasmid was performed using primers coMV-H61 N HA FWD (5’-TCGTGGTGCCAGATCTCACAGAGCCGCCATCTAT - 3’ ...
-
bioRxiv - Microbiology 2020Quote: A codon optimized Zika prME-NS1 gene (strain PRVABC59 Asian 2015; GenBank: ANW07476.1) was gene synthesized by GenScript. The recombinant ZIKV-NS1 was constructed as published previously (13) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: The plasmid encoding human FPR2 with an N-terminal SNAP-tag was obtained from Genscript (Piscataway, NJ, USA); it was constructed by replacing GLP1R in the previously described pcDNA3.1(+)-Flag-SNAP-GLP1R plasmid [26] with human FPR2 ...