Labshake search
Citations for Takara Bio :
101 - 150 of 2404 citations for Water PCR Grade since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were purified using NucleoSpin Gel and PCR Clean-up (TaKara Bio Inc.), and then analyzed and quantified by Nanodrop spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR with the SeqAmp PCR kit (Takara Bio USA, San Diego, CA). Unlike TARGET-Seq ...
-
bioRxiv - Plant Biology 2020Quote: CloneAmp HiFi PCR Premix (Takara) was used for all PCR amplifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... by RT-PCR (TaKaRa, RR014) and cloned by Gibson assembly into the vector pK27SUMO (expressing a 14His-tagged version of the yeast SUMO protein Smt3 ...
-
bioRxiv - Microbiology 2021Quote: ... 1× ExTaq PCR buffer (Takara, Clontech Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... SYBR Green PCR kit (Takara) was applied to conduct RT-qPCR ...
-
bioRxiv - Microbiology 2021Quote: ... using CloneAmp HiFi PCR (Takara) and was subcloned in the Thymidine kinase Cypridina plasmid (Thermofisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 μL PCR mixture (TaKaRa), 1 μL upstream primer (10 μmol/L) ...
-
bioRxiv - Microbiology 2021Quote: ... Comparative RT-PCR (Takara, Japan) was performed using SYBR Green Supermix via an RT-PCR machine (RocheLightCycler480 ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR was performed by TaKaRa EX Taq (Takara ...
-
bioRxiv - Biophysics 2023Quote: ... CloneAmp HiFi PCR Premix (Clontech) was used for all the PCR amplifications ...
-
bioRxiv - Biochemistry 2023Quote: ... by RT-PCR (Takara, RR014) and cloned by Gibson assembly into the vector pK27SUMO ...
-
bioRxiv - Genetics 2022Quote: ... then washed in water and re-suspended in 125-250mL -leu - his galactose liquid culture (Takara Bio Minimal SD Bases ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.5 μL nuclease-free water was added to 4 μL of 5x PrimeScript buffer (Takara, USA), 1 μL RNAse OUT (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Lyophilized RBD fragments were resuspended in water and used in downstream Infusion based cloning (Takara Bio) reactions to assemble full-length chimeric spike proteins ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time PCR was performed using the SYBR Green PCR master mix (Takara Bio Inc.) according to the manufacturer’s specifications ...
-
bioRxiv - Evolutionary Biology 2020Quote: PCR amplification was carried out using the Advantage GC 2 PCR Kit (Clontech Catalog #639119), and cloning was carried out using standard procedures (primer sequences are listed below).
-
bioRxiv - Plant Biology 2019Quote: ... Real-time PCR (qRT-PCR) was determined by using SYBR Premix Ex Taq II (TaKaRa) and performed on ABI Stepone real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR was done using SYBR/ TB Green RT PCR kit (Takara Bio) in Bio- Rad real-time PCR detection system ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR was done using SYBR/ TB Green RT PCR kit (Takara Bio) in Bio-Rad real-time PCR detection system ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative PCRs were performed using a SYBR PremixEX Taq II (RT)-PCR kit (Takara, Japan) on a Thermo PIKOREAL 96 real-time PCR System ...
-
bioRxiv - Neuroscience 2020Quote: ... Real-time PCR was carried out using SYBR Green PCR Master Mix (RR091A, Takara, Japan) and the quantitative analysis was performed using LightCycler Roche 480 qPCR instrument ...
-
bioRxiv - Microbiology 2020Quote: ... All PCR reactions were performed with CloneAmp HiFi PCR premix (Takara Bio, Mountain View, California) using 25 ng of DNA ...
-
bioRxiv - Zoology 2020Quote: ... Reverse transcription-PCR was conducted using a PrimeScript One-Step RT-PCR kit (Takara, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... and PCR reaction was performed using a miR-X miRNA qRT-PCR SYBR Kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... The final PCR product was subcloned into pCS2+ by Infusion PCR (Takara Bio, Kusatsu, Japan). For subcloning into N’3xGFP-pCS2+ ...
-
bioRxiv - Pathology 2022Quote: Reverse transcription PCR (RT-PCR) was performed with 500 ng RNA per reaction by TaKaRa PrimeScriptTM RT Master Mix (Perfect Real Time ...
-
bioRxiv - Genomics 2023Quote: ... The RT-PCR products were treated with NucleoSpin Gel and PCR Cleanup kit (Takara Bio) and directly analyzed using Sanger sequencing (Eurofins Genomics) ...
-
bioRxiv - Developmental Biology 2023Quote: Linear DNA fragments were amplified via PCR using CloneAmp HiFi PCR premix (Takara Bio, 639298). PCR products were cut from agarose gels and purified using the Nucleospin gel purification kit (Takara Bio ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was amplified by 15 cycles of PCR using the Advantage 2 PCR Kit (Clontech) with template switching custom oligo (TableS6) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Linear DNA fragments were amplified via PCR using CloneAmp HiFi PCR premix (Takara Bio, 639298). PCR products were cut from agarose gels and purified using the Nucleospin gel purification kit (Takara Bio ...
-
bioRxiv - Genomics 2019Quote: The 90-μL preparation volume for PCR contains 1X Advantage 2 PCR Buffer [not short amplicon (SA)](10X, Clontech, 639206, Advantage® 2 PCR Kit), 0.4-mM dNTP Mix (50X/10 mM ...
-
bioRxiv - Cancer Biology 2020Quote: ... primary lymphocytes were stimulated with IL-2 and anti-CD3 and retrovirally transduced with the anti-NY-ESO-1 TCR from clinical grade retroviral supernatants via RetroNectin (Takara Bio). Cells were expanded by a rapid expansion protocol involving soluble OKT3 ...
-
bioRxiv - Genetics 2020Quote: ... The PCR products were purified by Nucleospin® Gel and PCR Clean-up (740609-250; TAKARA).
-
bioRxiv - Genetics 2020Quote: ... eas and RhoGEF) for qRT-PCR were generated by PCR using Tks Gflex DNA Polymerase (TaKaRa) and gene-specific primers (Table S1) ...
-
bioRxiv - Cancer Biology 2019Quote: ... PCR amplification was performed using a CloneAmp™ HiFi PCR Premix (Takara, Mountain View, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using a SYBR Premix Ex Taq Kit (Takara) and a real-time PCR machine (CFX96 ...
-
bioRxiv - Microbiology 2020Quote: ... Both 1st PCR and 2nd PCR were performed by using PrimeSTAR HS DNA polymerase from Takara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... A 10,143 kb fragment was amplified by PCR in a thermal cycler (TaKaRa PCR Thermal Cycler) using the following primers ...
-
bioRxiv - Microbiology 2019Quote: ... and reverse transcription-PCR (RT-PCR) was carried out with a PrimeScript RT reagent kit (TaKaRa). The primers used for RT-PCR are listed in Table 3 ...
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... the first PCR reaction mixture (30 cycles) was purified with a PCR cleanup column (Takara Bio) and the eluate was used for the second PCR reaction (30 cycles) ...
-
bioRxiv - Genetics 2019Quote: ... PCR reactions contained 10 μl SapphireAmp Fast PCR Master Mix (Takara Bio USA, Mountain View, CA), 0.3 μl of each primer (10 μM stocks) ...
-
bioRxiv - Pathology 2021Quote: ... Mycoplasma contamination was confirmed by PCR using the TaKaRa PCR Mycoplasma Detection Set (Takara, Shiga, Japan).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Transcription template DNA fragments were amplified directly by PCR using PrimeStar Max PCR polymerase (Takara Bio), SPu-2 (5’–CAGTAAGCCAGATGCTACAC ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Two PCR amplicons were prepared in each case using CloneAmp™ HiFi PCR Premix (638500; Clontech) and were then gel-eluted using NucleoSpin® Gel and PCR Clean-up (740609.10 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products were purified using a NucleoSpin Gel and PCR Clean Up Kit (Takara Bio Inc.). Cycle sequencing reactions were performed directly using the two PCR primers using the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR product was purified using a NucleoSpin Gel and PCR Clean-up kit (Takara Bio), and Sanger sequencing was performed using primers 134 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR and quantitative-PCR were performed with Takara Taq Hot Start Version (TaKaRa Biotechnology, Shiga, Japan) or Power SYBR Green PCR master mix (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers and the T7 tag were added using PCR and the CloneAmp HiFi PCR Premix (TakaRa). Mutants (N127143Q and motif substitutions ...