Labshake search
Citations for Takara Bio :
601 - 650 of 773 citations for Vertical Electrophoresis system since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... the sequences corresponding to Flag tags were replaced by those encoding for Myc tags using the In-Fusion PCR cloning system (Takara) according to the kit’s guidelines ...
-
bioRxiv - Plant Biology 2023Quote: ... the chimeric H5Indo gene was reamplified by PCR and then introduced in the T-DNA region of a pCAMBIA binary vector previously linearized with restriction enzymes SacII and StuI using the In-Fusion cloning system (Clontech). Expression of H5Indo was driven by a 2X35S promoter from the cauliflower mosaic virus (CaMV) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T packaging cells were transfected with the required lentiviral cDNA constructs using Lenti-X packaging system following the manufactures protocol (631276, Takara). SKM cells stably expressing HA-GLUT4-GFP (SKM-GLUT4 cells ...
-
bioRxiv - Neuroscience 2023Quote: Transgene constructs that simultaneously encode FingR targeting PSD95 and membrane markers of neuronal morphology were made using the In-Fusion HD Cloning System (Clontech). First ...
-
bioRxiv - Plant Biology 2023Quote: ... and was cloned into the AscI site of the pENTR/D-TOPO entry vector containing full length MpNEK1 CDS (Otani et al., 2018) by In-fusion system (Takara). The resulting vector pENTR/D-TOPO-MpNEK1-mCitrine was subjected to LR reaction to transfer MpNEK1-Citrine fusion into the Gateway binary vector pMpGWB144 (MpEF1α pro:XVE >>LexA operator:Gateway cassette).
-
bioRxiv - Cancer Biology 2022Quote: Doxycycline inducible RARα expressing phyllodes tumor patient-derived cells (PT024 RARα) were established with Tet-On 3G system from Takara. Coding sequence of full-length WT RARα were cloned into a PLVX-Tre3G-IRES-GFP response vector ...
-
bioRxiv - Cell Biology 2023Quote: ... Separate populations were stably-transfected to express MLCK1-EGFP constitutively and mCherry-Ig3 inducibly via a Tet-on3G system (Clontech). Cells were maintained in high-glucose Dulbecco’s modified Eagle’s medium (Life Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... Constructs used to test protein-protein interactions were co-transformed into the yeast Saccharomyces cerevisiae strain AH109 using the Matchmaker Gold yeast two-hybrid system (Clontech). Empty pDEST-GBKT7 and pDEST-GADKT7 vectors were used as negative control ...
-
bioRxiv - Biochemistry 2023Quote: The full-length SKP1-FBXO22 fusion protein with a 3xGGGS-linker was cloned into a pNic-Bio2 vector that encodes for an N-terminal His-tag as well as a C-terminal Avi-tag (GenBank: JF912191) using an In-Fusion HD Cloning System kit (Takara), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... the CPER products (25 μl) were transfected into VeroE6/TMPRSS2 cells using TransIT-X2 Dynamic Delivery System (Takara, Cat# MIR6003) according to our previous report22 ...
-
bioRxiv - Cell Biology 2023Quote: ... 91 The plasmids pME-rtTA and p3E-TRE were made by inserting the Tet-On fragments from the Tet-On system (Clontech) in the appropriate Tol2 entry vectors ...
-
bioRxiv - Cancer Biology 2023Quote: ... MBP fusion TP63 cassettes were cloned into a lac-inducible MBP-6xHis-TEV bacterial expression vector using In-Fusion cloning system (Takara).
-
bioRxiv - Developmental Biology 2024Quote: ... Quantitative PCR (qPCR) was performed on the CFX Connect Real-Time PCR Detection System using SYBR Green PCR Master Mix (TaKaRa). Primer pairs used were listed in Supplementary (Table S2) ...
-
bioRxiv - Microbiology 2024Quote: ... MTase expression was then induced at 15°C according to the Cold Shock Expression System pColdTM DNA’s protocol (Takara Bio). 24 hours after the induction ...
-
bioRxiv - Plant Biology 2023Quote: ... Direct protein-protein interaction was confirmed by co-transformation of the respective plasmids into the yeast strain AH109 using the Matchmaker GAL4 Two-hybrid System (Clontech), followed by a selection of transformants on 2% SD (-Leu/-Trp ...
-
bioRxiv - Cell Biology 2023Quote: ... using the same paired read adapter oligonucleotides30) were prepared from the ChIP and Input DNAs on an automated system (Apollo 342, Wafergen Biosystems/Takara). After a final PCR amplification step ...
-
bioRxiv - Cell Biology 2024Quote: ... U-2OS cells stably infected with FLAG-CCND1/2xStrep-CCND2/HA-CCND3 were maintained in McCoy’s 5A medium supplemented with 10% Tet System Approved FBS (Takara, Clontech Laboratories) and 1% penicillin/streptomycin/L-glutamine (Corning Life Sciences) ...
-
bioRxiv - Plant Biology 2024Quote: ... two-hybrid assay was conducted according to the manufacturer’s instructions for the Match-maker Gold Yeast Two-Hybrid System (Clontech, USA). To generate the bait construct BD-GhCPK28 ...
-
bioRxiv - Molecular Biology 2024Quote: ... qRT–PCR was performed using SYBR Premix Ex TaqII (Tli RNaseH Plus) and the Thermal Cycler Dice Real Time System (TaKaRa). The data were normalized using 18S rRNA as a reference ...
-
bioRxiv - Plant Biology 2024Quote: ... The qRT-PCR analysis was performed using the ABI StepOne Plus PCR system and the SYBR Green Realtime PCR mix (Takara). The ubiquitin gene (Lj5g3v2060710 ...
-
bioRxiv - Plant Biology 2024Quote: The yeast two-hybrid assays were carried out using a mating-based split ubiquitin system (mbSUS) for membrane protein interactions as described “mbSUS tests protocol” (Clontech) (Obrdlik et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... The qPCR reactions were carried out and the signals were detected using a real time PCR system (catalog no. TP950, TaKaRa). For RT-qPCR ...
-
bioRxiv - Plant Biology 2024Quote: ... Bait and prey constructs were transformed into the haploid yeast strains Y2HGold and Y187 (Matchmaker Gold Yeast Two-Hybrid System, Clontech), respectively ...
-
bioRxiv - Neuroscience 2024Quote: ... and then the tip of the recording electrode was broken into the nested PCR reagent system (Prime ScriptTm RT reagent Kit with QDNA Eraser, Cat: RR0471, Takara), and a cDNA synthesis kit was used to synthesize cDNA following the manufacturer’s protocol (PrimeScriptm II1st Strand cDNA Synthesis Kit) ...
-
bioRxiv - Cell Biology 2024Quote: ... The construct was then used as a donor template for ssDNA production by Guide-it Long ssDNA production system v2 (TAKARA). Following primers (GCATCAGTATTAAATACACATG ...
-
bioRxiv - Developmental Biology 2023Quote: ... All RT-qPCR reactions were carried out in triplicate using ThunderBird SYBR qPCR Mix (TOYOBO) and Thermal Cycler Dice Realtime System (TAKARA), and normalized to mRNA expression level of human ribosomal protein L13A ...
-
bioRxiv - Cell Biology 2024Quote: ... Pairs of pGBKT7 and pGADT7 plasmid were co-transformed into the yeast strain AH109 following the MatchmakerTM GAL4 Two-Hybrid System instructions (Clontech). Primary transformants were selected on synthetic drop-out (SD ...
-
bioRxiv - Cell Biology 2024Quote: ... HMECs and MCF10AT1 expressing tetracycline-inducible wild type SAS-6 or SAS-6ND were obtained via lentiviral gene transduction with the pLVX tet-on Advanced inducible gene expression system (Clontech) (Fong et al. ...
-
bioRxiv - Plant Biology 2020Quote: ... The vector was linearized using SmaI and the activator system was added using In-Fusion cloning (In-Fusion® HD Cloning Plus, Takara) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... The yeast one-hybrid (Y1H) assay was conducted using the Matchmaker™ Gold Yeast One-Hybrid Library Screening System kit (Cat. no. 630491, Clontech).
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative RT-PCR analysis was performed on an Agilent Real-Time qPCR apparatus (Mx3000P system) using SYBR Premix ExTaq TM II (Takara, Japan). Biological replicates for each set of experiments were carried out three times ...
-
bioRxiv - Plant Biology 2021Quote: Yeast strain AH109 was transformed with bait (pGBKT7) and prey (pGADT7) constructs by following the small scale yeast transformation protocol from Yeastmaker™ Yeast Transformation System 2 (Clontech). Upon transformation ...
-
bioRxiv - Microbiology 2021Quote: ... pBICP35-CE1–CE8 transient expression vectors under the control of the 35S promoter were constructed using an In-Fusion system (Clontech, TaKaRa). The fragment containing the cDNA of CE1 was amplified with the primers 35S_CE1_Fw and 35S_CE1_Rv ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adeno-associated virus pseudotype 6 (AAV6) expression vector encoding ARP5 was constructed using AAVpro Helper Free System (AAV6) (TAKARA BIO). Finally ...
-
bioRxiv - Plant Biology 2022Quote: ... The recombinant constructs was transformed into Y1H gold strain and Y1H assay was performed using Matchmaker® Gold Yeast One-hybrid screening system (Takara) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Single cell polyA[+] RNA-seq on the C1 was performed using the SMART-Seq v4 Ultra Low Input RNA Kit for the Fluidigm C1 System (Takara, 635026) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Full-length cDNAs were generated on the Fluidigm C1 system using the SMART-Seq v4 Ultra Low Input RNA kit (Clontech, 635026) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... with a flag tag at the N terminal and an EGFP tag at the C terminal by the In-Fusion HD Cloning system (TaKaRa, 638909). After transfection of the U2OS cells with the pCMV-Tet3G Vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant OmpA-pGBKT7 and Flg-pGBKT7 were finally transformed into Y2H Gold yeast strain separately using Yeastmaker yeast transformation system (Takara, Clontech).
-
bioRxiv - Molecular Biology 2021Quote: ... The purified ds CDNA was finally co-transformed with pGAD-T7 Rec into competent Y187 using Yeastmaker yeast transformation system (Takara, Clontech) and plated on SD-Leucine agar media ...
-
bioRxiv - Immunology 2019Quote: ... conjugated to vinculin or the vinculin A50I mutant were cloned into the doxycycline-inducible Tet-On 3G plasmid system (Takara Bio). HoxB8-conditional progenitors (expressing Cas9 and control sgRNA or Vcl (2 ...
-
bioRxiv - Biophysics 2021Quote: ... The rTetR protein sequence was subcloned from the Tet-On transactivator used in the commercially available Tet-On 3G system (Takara Bio). FUSN was derived from Addgene #122148 and GBP was based on a previously described construct (Rothbauer et al. ...
-
bioRxiv - Genomics 2020Quote: ... 2 μg of total RNA per sample was used to generate first-strand cDNA using reverse transcription system (Takara, Dalian, China). Quantitative RT-PCR was performed using SYBR Premix Ex Taq (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... The LightCycler 480II PCR system was programmed according to the instructions of the SYBR Premix Ex Taq II (Perfect Real Time) kit (TaKaRa, China) to conduct fluorescence-based quantitative PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... we used the nuclear system Y2H mating standard operating procedure method as described in the manufacturer’s instructions (Clontech Laboratories, Inc., USA) to screen the protein that interacts with TiAP1 and further verified the obtained interaction protein ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR products were purified and cloned into binary vector pGreenII-0800-LUC linearized by SmaI using In-Fusion cloning system (Clontech, USA), respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with 0.04% Bovine Serum Albumin and prepared for single-cell separation and labeling using the iCELL8 Single-Cell System (Wafergen, Takara Bio) according to the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2021Quote: ... Products were ligated to pCAMBIA1300 vector backbone containing the 35S promoter and a C-terminal YFP using the In-Fusion cloning system (Takara Bio).
-
bioRxiv - Plant Biology 2020Quote: ... The recombinant plasmid was used as bait to screen the cDNA library using the Matchmaker™ Gold Yeast Two-Hybrid Library Screening System kit (Cat. no. 630489, Clontech).
-
bioRxiv - Cancer Biology 2021Quote: We quantified mRNA expression levels of IL-10 and chemokines identified in the RNA-Seq analysis using 2-step real-time RT-PCR (Thermal Cycler Dice Real Time System, Takara Bio). The ribosomal protein L13a (RPL13A ...