Labshake search
Citations for Takara Bio :
151 - 200 of 402 citations for SDS PAGE Single gel since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... linearized chimeric H3 HA sequence was gel purified using the NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were analysed by gel electrophoresis and positive products were purified using the NucleoSpin Gel and PCR clean up kit (Clontech, Takara Bio) before being sent for sequencing by Eurofins Genomics (Germany) ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting probe reaction mixtures were electrophoresed on a 0.8% agarose gel for 30 min at 100 V and then gel purified with a NucleoSpin Gel and PCR Clean-up kit (Takara Bio USA). The EMSA binding reaction ...
-
bioRxiv - Immunology 2023Quote: ... The DNA product was purified from the gel slice using the PCR cleanup and gel extraction kits (740609.50, Takara Bio, Kusatsu, Shiga). The purified DNA was cleaned using AMPure XP (A63881 ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products were analysed by gel electrophoresis and positive products were purified using the NucleoSpin Gel and PCR clean up kit (Clontech, Takara Bio) before being sent for sequencing by Eurofins Genomics (Germany) ...
-
bioRxiv - Cell Biology 2022Quote: Single guide RNAs (sgRNAs) in the pX330 vector (1 μg) were mixed with EGFP (0.1 μg; Clontech) and co-transfected into MAP4K3 k.o ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... single-stranded cDNA was generated from RNA using the SMARTer cDNA synthesis kit (Clontech, Palo Alto, CA) with tagged oligo-dT primers that include one of eight 15-bp barcodes to distinguish individual samples (2 species x 2 tissues x 2 biological replicates) ...
-
bioRxiv - Molecular Biology 2022Quote: Single cells were prepared using the STORM-seq protocol (referencing the SMART-Seq Stranded Kit – Takara Bio) on the SPT Labtech Mosquito (HV) ...
-
Maternal transmission of a paramutant phenotype requires intact DNMT2 functions in the male germlinebioRxiv - Genetics 2020Quote: ... The single cell cDNA libraries were made using SMART-Seq v4 Ultra Low Input RNA Kit (Takara). The cDNAs were fragmentized and Illumina Sequencing adaptors were added using Nextera DNA Library Preparation Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA were extracted from each well and converted into cDNA using SAMRT-Seq Single cell kit (Takara). DNA library was made and sequenced at Single Cell Genomic Core at the Baylor College of Medicine ...
-
bioRxiv - Genetics 2023Quote: ... Plasmids that contain each sgRNA were transfected to HEK293T cells using Lenti-X packaging single shots (Takara) for viral packaging ...
-
bioRxiv - Genomics 2024Quote: ... Both reagents were included in SMART-Seq Single Cell PLUS kit (Takara Bio, San Jose, CA, U.S.). Immediately after sampling in lysis buffer ...
-
bioRxiv - Immunology 2022Quote: ... The assembled full-length inserts were gel purified (Takara), digested with EcoRI (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... in a Mupid-One gel electrophoresis system (TaKaRa, Japan). RNA samples were purified for the second time by the TRIzol method as mentioned above and were stored at −80°C until further analysis.
-
bioRxiv - Molecular Biology 2024Quote: ... Agarose gel electrophoresis on a Mupid EX system (Takara) was performed in 400 mL of 1× MOPS buffer at 20 V for 20 min and then at 100 V until the bromophenol blue dye migrated approximately 2/3 of the gel ...
-
bioRxiv - Developmental Biology 2024Quote: ... the larvae were embedded in agarose gel (5805A, Takara) in E3 buffer supplemented with anesthesia and N-phenylthiourea and observed using a TE2000 microscope (Nikon ...
-
bioRxiv - Molecular Biology 2020Quote: LNA/DNA probes (PAGE grade, fasmac, Table SX) were labelled with 32P-γ-ATP by means T4PNK (Takara), followed to filter by MicroSpin G-25 Columns (GE healthcare) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and SD-BRCA1 were harvested and lysed with the xTractor bacterial cell lysis buffer (Clontech) and sonication ...
-
bioRxiv - Plant Biology 2021Quote: ... Transformants were selected by cultivation for 2 days on minimal synthetic defined (SD) media (Clontech) lacking Leu (pACT2-GW ...
-
bioRxiv - Plant Biology 2023Quote: ... Positive yeast colonies were selected and confirmed by using different synthetic drop-out (SD) (Takara) media prepared according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Both back bones and inserts were then agarose-gel purified using NucleoSpin® Gel and PCR Clean-Up columns (Takara Bio USA, Inc.). Purified fragments then mixed at prescribed molar ratio together with In-Fusion HD Cloning Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... a single-stranded donor for homologous recombination was generated using the Guide-it Long ssDNA Production System (Clontech). The gRNA ...
-
bioRxiv - Cell Biology 2022Quote: cDNA was generated from single cells in the 96-well plate using the SmartSeq v4 kits (Takara Bio) using 1/4th volume reactions dispensed using a Mantis dispenser (Formulatrix) ...
-
bioRxiv - Plant Biology 2021Quote: ... Each of the 27 libraries were sequenced on a single SMRT cell (1M,v3 for Teloprimev2 and Clontech) on a PacBio Sequel machine using a 10hr (v3 ...
-
bioRxiv - Microbiology 2020Quote: ... converted to single stranded cDNA and amplified using the SMARTer PCR cDNA Synthesis Kit (Takara Bio, Kusatsu, Japan), and IsoSeq libraries were constructed with equimolar cDNA fractions (0.5X and 1X ...
-
bioRxiv - Pathology 2022Quote: ... Single-stranded cDNA was reverse transcribed using Prime Script RT Master Mix (Perfect Real Time) (Takara Bio Inc.), and used for subsequent real-time PCR reactions ...
-
bioRxiv - Immunology 2022Quote: ... Cells were lysed using Takara Bio Single Cell Lysis Buffer containing a recombinant RNase inhibitor (Takara Bio Inc.) then snap frozen ...
-
bioRxiv - Neuroscience 2019Quote: ... Single stranded cDNA from the total RNA was synthesized with a RT-PCR kit (Clontech, Mountain View, CA) according to the kit’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... single nuclei were sorted into 8-well strip tubes containing 11.5μl of SMART-seq v4 collection buffer (Takara) supplemented with ERCC MIX1 spike-in synthetic RNAs at a final dilution of 1×10-8 (Ambion) ...
-
bioRxiv - Neuroscience 2023Quote: ... by dispensing individual cells in 5 nL drops directly into 3 µL ice-cold single cell lysis buffer (scLB, 0.134% Triton X-100 [Sigma], 0.5 U/µL recombinant RNase inhibitor [Takara, 2313B] ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Plant Biology 2024Quote: Single or multiple DNA fragments were cloned into binary vector using In-Fusion HD Cloning Kit (Clontech, USA). Briefly ...
-
bioRxiv - Developmental Biology 2024Quote: Single-cell cDNA synthesis was performed using SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara) according to the manufacturer’s protocol with some modifications as previously described17 ...
-
bioRxiv - Cell Biology 2024Quote: ... 7 μg of lentiviral vectors was mixed with a Lenti-X packaging (VSV-G) single shots tube (Clontech) in a final volume of 600 μl for 15 min before the transfection mix was added to subconfluent (80-90% ...
-
bioRxiv - Bioengineering 2024Quote: ... The two fragments were assembled in a single In-Fusion reaction (In-Fusion HD Cloning Kit, Takara, 639650), and the PCR-derived regions of the resulting plasmids were confirmed by sequencing.
-
bioRxiv - Molecular Biology 2019Quote: ... 1.8 µl of reaction stop solution containing 5.3% SDS and 6.6 mg/ml proteinase K (Takara) was added and the sample was incubated for 60 min at 37°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal (Takara Bio, USA). Plates were imaged after incubation for 60 - 72 hr at 30°C unless otherwise stated ...
-
bioRxiv - Plant Biology 2021Quote: ... Co-transformants were selected by cultivation for 2 days on minimal synthetic defined (SD) media (Clontech) lacking Leu (pACT2-GW ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.8 μl reaction stop solution containing 5.3% SDS and 6.6 mg/mL proteinase K (9034, Takara) was added and the sample was incubated for 60 min at 37°C ...
-
bioRxiv - Plant Biology 2023Quote: ... and then cloned into pENTR/D/SD entry vector using the In-Fusion cloning kit (Takara). Inserts of all plasmids were sequenced by Macrogen ...
-
bioRxiv - Physiology 2021Quote: ... and gel extracted (Clontech Nucleospin Extract II Kit Cat# 636972). The linearized and purified pMLM313 fragment was used as template for in vitro transcription of Cas9 mRNA with mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies)16 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Following purification with Zymoclean Gel DNA Recovery Kit (ZD4008, Takara), product size distribution and quantity were assessed on a Bioanalyzer using an Agilent 2100 high-sensitivity DNA assay kit (5067-4626 ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified using NucleoSpin Gel and PCR Clean-Up Kit (Takara), cloned into pRACE vector (provided in the kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplicons were sized in gels (as above) and bands of interest isolated using the NucleoSpin Gel and PCR Clean-up kit (Takara Bio Inc., San Jose, CA). Sanger Direct Sequencing was performed at Azenta Life Sciences (South Plainfield ...
-
bioRxiv - Cell Biology 2020Quote: ... The RNA was reverse-transcribed to single-stranded cDNA using the AMV Reverse Transcription System (Takara, Dalian, Liaoning, China). Then ...
-
bioRxiv - Genomics 2020Quote: ... using a Multi Sample Nano Dispenser (MSND, SMARTer™ ICELL8® Single-Cell System, Takara Bio USA, CA, USA). Chip wells were sealed using SmartChip Optical Imaging Film (Takara Bio USA ...
-
bioRxiv - Neuroscience 2020Quote: ... Single cells were converted to cDNA and amplified using Smart-Seq V4 Ultra Low Input RNA Kit (Takara Bio). The cDNA output was then processed with Nextera XT DNA Library Preparation Kit ...
-
bioRxiv - Developmental Biology 2023Quote: ... prior to cells being fully resuspended to a single-cell suspension in 2mL NDiff227 with a 1mL pipette (Takara). Using a multichannel pipette ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 100 microglia from each region were collected in 5 μL single-cell lysis buffer (635013, Takara), and flash-frozen on dry ice.
-
bioRxiv - Neuroscience 2023Quote: ... Plasmid DNA used to generate lentiviral particles were transfected into HEK293 cells using LentiX single-shot VSV-G (Takara) following manufacturer’s instructions ...