Labshake search
Citations for Takara Bio :
51 - 100 of 6460 citations for Mouse Starch Binding Domain Containing Protein 1 STBD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentrations were estimated using a BCA Protein Assay Kit (Takara). For FRAP experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Membrane was blocked overnight in 5% milk-TBS + 1% Tween and incubated the next day with a primary antibody directed against the Gal4-activation domain (1:5,000 dilution; Clontech, cat # 630402) or against human Ku70p (1:1,000 dilution ...
-
bioRxiv - Plant Biology 2019Quote: ... proteins were transferred to PVDF membrane and blotted proteins were incubated in a 1:10,000 dilution of mouse monoclonal anti-GFP antibody (Living Colors JL-8, Clontech) followed by 1:5000 horseradish peroxidase conjugated sheep anti-mouse IgG antibody (Amersham ...
-
bioRxiv - Molecular Biology 2019Quote: ... the MS2 binding sites were amplified with primer pair 1 (Supplementary File 1: Table S4) and cloned into pEGFP-C1 (Clontech) as EcoRI/BamHI fragment ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration was determined by a BCA protein assay kit (TakaRa) using bovine serum albumin (BSA ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
bioRxiv - Microbiology 2022Quote: ... Virus production was quantified by determining the amount of the Gag p24 protein using an enzyme-linked immunosorbent (ELISA) assay (Innogenetics or TaKaRa). For production of HIV-1 Env-pseudotyped viruses in Jurkat cells ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The α1-subunit genes were inserted at the PH promoter of vectors already containing the corresponding β1-subunit proteins using In-Fusion® HD Cloning Kit (Takara Bio, USA Inc.) and control sequenced ...
-
bioRxiv - Biochemistry 2020Quote: Site-directed mutagenesis H >A of the HPGG motif of the Cyt-b5 domain was either performed by Genescript (N. benthamiana) or using In-Fusion® HD cloning kit (Takara Bio, Kusatsu, Japan) for Synechocystis after amplification using two mutagenic complementary primers for amplifying pTHT2031-Ot5H46A-S and pTHT2031-Ot10H20A-S from pTHT2031-Ot5-S and pTHT2031-Ot10-S ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Protein concentrations were measured with a BCA protein assay kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was quantified using the BCA protein assay kit (Takara Bio, T9300A). Cell lysates (about 200 µl ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Microbiology 2022Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Infections of fully differentiated MDM were performed after adherent growth in the presence of M-CSF for seven days ...
-
The Ets protein Pointed P1 represses Asense expression in type II neuroblasts by activating TaillessbioRxiv - Developmental Biology 2021Quote: ... 1-298) (EnR) or the Ets domain of PntP1 were amplified by CloneAmp HiFi PCR Premix (Catalog# 639298, Takara Bio., Mountain View, CA) from genomic DNAs of the UAS-PntP1 line ...
-
bioRxiv - Developmental Biology 2022Quote: c-Kit-EGFP fusion protein: chicken c-Kit cDNA was inserted into multiple cloning site of pEGFP-N1 Vector (Clontech, #6085-1) including EGFP sequences using a primer set ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 1% protease inhibitor (Clontech, Mountain View, CA) and 1% phosphatase inhibitors (Millipore Sigma) ...
-
bioRxiv - Neuroscience 2019Quote: ... containing 1% protease inhibitor (Clontech, Mountain View, CA) and 1% phosphatase inhibitors (Millipore Sigma) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg of total RNAs were reverse-transcribed into cDNA at 42°C for 1 h in 20 μl reaction mixture containing mouse Moloney leukemia virus reverse transcriptase (PrimeScript, TAKARA BIO, Shiga, Japan) with random 6 primers (TAKARA BIO) ...
-
bioRxiv - Neuroscience 2022Quote: ... protein lysate was immunoprecipitated for 2 h at 4°C with the following antibodies: mouse anti-GFP (1:1000; Takara Bio), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Biochemistry 2019Quote: ... 500 µg protein at 1 mg/mL were prepared with Buffer A (Phosphoprotein Kit, Clontech, Cat#635626): 185 µL PC-3 lysate (pH 8.8) ...
-
bioRxiv - Plant Biology 2021Quote: ... The fused proteins were purified with the GST-tagged protein purification kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein concentration was determined using the BCA protein assay kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein concentration was quantified using the TaKaRa BCA Protein Assay Kit (TaKaRa, Japan), and 2-mercaptoethanol (Nacalai Tesque ...
-
bioRxiv - Bioengineering 2023Quote: ... Using a BCA protein kit (TaKaRa, Shiga, Japan), a working solution (BCA reagent A ...
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
bioRxiv - Bioengineering 2021Quote: ... The virus titre was calculated using the ELISA-based Lenti-X™ p24 Rapid Titer Kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-GFP (Clontech, 1:5000) rat anti-RFP (Chromotek ...
-
bioRxiv - Molecular Biology 2023Quote: ... His6 (631212, Clontech, mouse, 1:500); NPL4 (sc-365796 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-GFP (Clontech,1:6,000), mouse anti-FLAG (Millipore-Sigma ...
-
bioRxiv - Plant Biology 2020Quote: All SUMO CDS were translationally fused with the activation domain of pGADT7 AD (Takara Bio). βC1 was fused with binding domain and cloned into pGBKT7 BD (Takara Bio) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Domain swapped HsPLZF was constructed by inverse PCR and the In-Fusion system (Takara Bio). Deletion mutation and amino acid mutation of each protein was performed by inverse PCR.
-
bioRxiv - Microbiology 2021Quote: ... PCR amplifications were conducted in 50-μL total volumes containing 1 μL of template DNA using an ExTaq kit (Takara). The cycling protocol was as follows ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein purity and concentration were determined by SDS-PAGE and BCA protein assay kit (Takara) respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... Total protein was quantified using the TAKARA BCA Protein Assay Kit (TAKARA Bio Inc., Japan). Equal amounts of protein were separated by SDS-PAGE on 10% gels ...
-
bioRxiv - Developmental Biology 2020Quote: ... Northern blot analysis was performed on a membrane containing RNA from adult mouse tissues (Clontech). As probe ...
-
bioRxiv - Cell Biology 2022Quote: Every protein expressed in mouse rods was also cloned into pEGFP-N1 (Clontech) for expression in AD293 cells using the AgeI and NotI cloning sites within the vector to replace EGFP with the tagged proteins ...
-
bioRxiv - Cell Biology 2020Quote: ... putative miR-31-5p binding sequences were deleted in the plasmid DNA using PrimeSTAR Mutagenesis Basal Kit (TaKaRa Bio, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... The Bradford protein assay kit was purchased from Takara Bio (Shiga ...
-
bioRxiv - Biophysics 2024Quote: Lentivirus titration was determined by p24 ELISA using Lenti-X™ p24 Rapid Titer Kit (Takara Bio, no. 632200) and a plate reader (PerkinElmer Victor3 V) ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatants containing soluble target proteins were loaded into a Talon metal affinity resin (Clontech, USA). After washing three times with buffer A ...
-
bioRxiv - Cancer Biology 2023Quote: ... a region spanning the ENE domain was amplified by conventional PCR (PrimeStar HS mix, Takara Bio) with primer sequences listed in Table S9 ...
-
bioRxiv - Immunology 2021Quote: ... and the protein concentration was measured by BCA protein assay kit (TaKaRa, Dalian, China, cat#T9300A) as previous described(Ma et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protein concentration was found to be 0.9 µg/µl using BCA Protein Assay Kit (TaKaRa).
-
bioRxiv - Physiology 2022Quote: ... Obtained luminescence was normalized to total protein concentration measured by BCA protein assay kit (Takara Bio).
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit; Takara, Shiga, Japan) after 1% SDS was added to solubilize the samples ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-mCherry 1:500 (632543, Clontech); chicken anti-Gfp 1:500 (ab13970 ...