Labshake search
Citations for Takara Bio :
301 - 350 of 6460 citations for Mouse Starch Binding Domain Containing Protein 1 STBD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned into a modified pCaSpeR4 vector containing the αTub84B promoter (Marois et al., 2006) using In-Fusion cloning kit (Takara Bio, Japan). Forward primer sequence was 5’-CTAGAGGATCCCCGGGTACCATGGTGAGCAAGGGCGAG-3’ and reverse primer sequence was 5’-TCGAGGGGGGGCCCGGTACCTTAATTGTAAGTAATACTAGATCCAGGGTATAAAGTT GTTC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: The pCAG-MDM4 expression vector was established by cloning of MDM4 sequence into a pCAG vector47 containing a multiple cloning site (pCAG-MCS) using In-Fusion® Snap Assembly Starter Bundle kit (#638945; Takara Bio). A single restriction digest was performed on the pCAG-MCS vector using XhoI (Cat ...
-
bioRxiv - Molecular Biology 2024Quote: The full length BRD4 DNA fragment was amplified by PCR from pcDNA4-TO-HA-BRD4FL (Addgene plasmid #31351)61 incorporated into linearized FM5 lentiviral vectors containing standardized linkers (generously provided by David Sanders) using the In-Fusion HD cloning kit (Takara Bio, 638910). BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Cancer Biology 2021Quote: ... a WST-1 cell proliferation assay kit (MK400, Takara Bio) was used according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The upstream and downstream regions adjacent to the binding site were amplified using Advantage 2 polymerase (Takara Bio, Shiga, Japan) from 3T3-L1 genomic DNA and cloned into the HR110-PA-1 vector (System Biosciences) ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by SDS–PAGE and immunoblotting with goat anti-GST (1:3000, Cytiva, 27-4577-01) and mouse anti-6xHis (1:3000, Takara Bio, 631212) antibodies ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Plant Biology 2019Quote: Primary antibodies were monoclonal antibodies from mouse: α-GFP (JL-8, 1:5000, Takara, Shiga, Japan) or rat ...
-
bioRxiv - Microbiology 2022Quote: ... Input and elution samples were analyzed by immunoblot using mouse anti-GFP (1:5,000, Clontech #632381) to detect A3-EGFP ...
-
bioRxiv - Cell Biology 2023Quote: ... Immunoblotting was performed using an anti-GFP mouse monoclonal antibody (JL8; 1:1000; TaKaRa Bio Inc.) and an anti-ubiquitin mouse monoclonal antibody (P4D1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were stained with anti-mouse E-cadherin monoclonal antibody ECCD-2 (1:100, Takara) for 16 h at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... MYC (mouse, Clontech, 631206 ...
-
bioRxiv - Physiology 2021Quote: ... Brain sections were then incubated overnight at room temperature in blocking solution containing primary antiserum (rat anti-mCherry, Life Technologies M11217, 1:1,000; rabbit anti-dsRed, Clontech 632496 ...
-
bioRxiv - Neuroscience 2022Quote: ... Incubation with primary antibodies was performed in blocking buffer containing rabbit anti-DsRed (1:1000, 632496; Clonetech-Takara Bio, Japan) antibody at 4°C for 1–2 days ...
-
bioRxiv - Cancer Biology 2022Quote: Telomerase-mediated extension and subsequent amplification of TRAP products were conducted in 25-µL reactions containing 1 µL of cell lysate and 2 U of Titanium Taq DNA polymerase (Takara). The other kit components—TRAP reaction buffer ...
-
bioRxiv - Immunology 2023Quote: The medium from transfected HEK293T cells was replaced with Opti-MEM containing 1 μM of B/B Homodimeriser (AP20187; Clontech) and incubated for 30 min ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Tissues expressing mCherry-tagged Yellow protein (ymCherry) were stained with rabbit anti-dsRed (Clontech 632496, 1:1000) and rat anti-DN-Cadherin (DN-Ex #8 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Concentrated protein was bound to 0.5–1 mL of His60 nickel or HisTalon cobalt resin (Takara Bio) for 0.5–1 hr at 4°C while rotating in a 10-mL Pierce disposable column (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2019Quote: ... Proteins were transferred onto a PVDF membrane and blotted using 1:2000 a-GFP (Cat 632381, Clontech), 1:2000 a-actin (AS13 2640 ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies were directed against IBA1 (rabbit-anti-iba1 WAKO chemicals 019-19741 1:1000) and tdTomato (mouse-anti-dsRed Takara 632392 1:1000). Secondary antibodies were goat anti-rabbit or anti-mouse conjugated with Alexa dyes 488 and 568 (1:1000) ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-nc82 (mouse, 1:10; Developmental Studies Hybridoma Bank, Iowa City, IA, USA) and anti-DsRed (rabbit, 1:500; Takara Bio, Kyoto, JP). Brains were washed three times again in PBS with 0.2% Triton X-100 and transferred into secondary antibody solution (anti-chicken Alexa Fluor 488 ...
-
bioRxiv - Neuroscience 2023Quote: ... the brain slices were first blocked in 10% goat serum made in 0.1% Triton X-100/1× PBS and then incubated in anti-GFP antibodies (1/1000, RT, overnight, Mouse anti-GFP, 632381, Takara Bio USA, WI) followed by Alexa-488 secondary antibodies (1/200 ...
-
bioRxiv - Systems Biology 2022Quote: Following the transfer of samples into a 384-well plate containing RT-PCR buffer with 3’ SMART-Seq CDS Primer IIA (SMART-Seq® v4 PLUS Kit, TaKaRa, cat# R400753); the samples were immediately denatured at 72ºC for 3 min and chilled on ice for at least 2 min ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 100 ng/ml Doxycycline (Clontech #631311) and 0.1 μl RNAiMAX per pmol siRNA (Thermofisher Scientific #13778150 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR fragments containing pLib vector backbone (Clontech) and EF1A promoter ...
-
bioRxiv - Microbiology 2020Quote: ... Total protein was extracted from 2,000 midguts using the lysis buffer supplied in the Capturem IP & Co-IP kit (Takara, 635721). The extracted proteins were divided into two equal parts and used for immunoprecipitation (IP) ...
-
bioRxiv - Microbiology 2022Quote: ... and E484Q mutations of the SARS-CoV-2 spike protein were determined by qPCR using mutation detection kits purchased from Takara Bio (Shiga ...
-
bioRxiv - Cell Biology 2023Quote: ... crossed with WT BDF1 males at E0.5 and electroporated with RNP complex of Mavs targeting sgRNA (100 ng μL-1) and Cas9 protein (Takara Bio; 500 ng μL-1) using NEPA21 electroporator ...
-
bioRxiv - Genomics 2019Quote: ... 1-mM SMARTer Kit dNTP Mix (10 mM each; Clontech, 634936), 1.2-μM SMARTer Kit SMARTer II A Oligonucleotide (12 μM ...
-
bioRxiv - Cell Biology 2020Quote: Antibodies used in this study were as follows: mouse anti-GFP (JL-8, dilution 1:1000) (Clontech); Alexa 488- ...
-
bioRxiv - Cell Biology 2023Quote: ... The following antibodies were used for the study: mouse anti-GFP (632381, JL-8, Clontech, 1:1000), rabbit anti-mCherry (GTX128508 ...
-
bioRxiv - Biophysics 2021Quote: ... Constructs containing both His and Strep tags were purified using gravity flow columns containing His60 Ni-NTA resin (Clontech) followed by Streptactin affinity chromatography (IBA Lifesciences ...
-
bioRxiv - Microbiology 2021Quote: ... 5′-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... 5’ s-RACE cDNA was obtained from bulk-sorted B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA from mouse cochleae was extracted using an RNA Extraction Kit according to the manufacturer’s instructions (#9767, TaKaRa, Japan). The extracted RNA concentration was measured using a Nanodrop 2000 spectrophotometer (#ND-LITE ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The immunoglobulin PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Neuroscience 2021Quote: Total RNAs from the mouse forebrain were reverse transcribed using the PrimeScript II first strand cDNA Synthesis Kit (Takara Bio) with the random hexamer primer ...
-
bioRxiv - Immunology 2020Quote: ... 10ng of RNA was used to prepare bulk TCR-seq libraries using the SMARTer Mouse TCR a/b Profiling Kit (Takara) according to instructions ...
-
bioRxiv - Immunology 2023Quote: ... A cDNA library for TCR was prepared from RNA using a SMARTer Mouse TCR a/b Profiling Kit (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA encoding ZP3 was restored from the mouse ovarian tissue by RT-PCR using PrimeScript RT Reagent Kit (Takara, RR037). Two PCR amplicons including the 5′ region of the TECTA-ZP and the transmembrane domain (TMD ...
-
bioRxiv - Genetics 2021Quote: ... was amplified from genomic DNA isolated from tail and peripheral blood using 1 µl of prepped DNA in 20 µl of PCR reaction containing 0.4 µl of PrimerStar GXL (TAKARA Bio, R050A), 4 µl of 5× Buffer ...
-
bioRxiv - Biochemistry 2020Quote: Inducible K562 cells were plated at 2.5×105 cells mL−1 in RPMI 1640 containing 0.25 μg/mL doxycycline (dox) (Takara Bio USA Inc.) in 10 cm plates and incubated at 95% humidity ...
-
bioRxiv - Plant Biology 2020Quote: ... The qRT-PCR assay was performed using 1/20 diluted cDNA as templates in the reactions containing SYBR® Premix Ex TaqTM II (TaKaRa). The qRT-PCR assay was conducted in triplicate in an ABI 7500 Fast Real-Time PCR System ...
-
bioRxiv - Genomics 2021Quote: ... 10 ng of cfDNA was dephosphorylated in a 10-μL reaction containing 2.5 μL of 10× TACS buffer and 1 μL of shrimp alkaline phosphatase (Takara Bio Inc.) at 37 °C for 15 min ...
-
bioRxiv - Cell Biology 2023Quote: ... The lentivirus was produced in DMEM containing 10% FBS and 1% BSA and then concentrated by the Lenti-X concentrator (Takara Bio).
-
bioRxiv - Evolutionary Biology 2022Quote: ... The ATP1A1 genes were inserted at the PPH promoter of vectors already containing the corresponding ATP1B1 genes using In-Fusion® HD Cloning Kit (Takara Bio; Cat#638910) and confirmed by sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Plant Biology 2024Quote: ... The PLT2-GFP fusion protein abundance was detected by using anti-GFP (cat#632381, 1:3,000 dilution; Clontech) and anti-ACTIN (cat#MA1-744 ...
-
bioRxiv - Immunology 2021Quote: ... The TSO was designed with two isodeoxynucleotides at the 5’ end to prevent TSO concatemerization and three riboguanosines at the 3’ end for increased binding affinity to the appended deoxycytidines (property of the Takara reverse transcriptase) (56 ...