Labshake search
Citations for Takara Bio :
401 - 450 of 6565 citations for Mouse Direct PCR Kit For Genotyping since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... RT–PCR was performed using a TB Green TM Premix Ex Taq Kit (Cat# RR820A, Takara) on a Light Cycler Real-Time PCR System (480II ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... RT-PCR was performed with the SYBR Premix Ex TaqTM kit (DRR041A, Takara Bio, Shiga, Japan) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2023Quote: ... and extension were all completed with the SMARTer PCR cDNA Synthesis Kit (Takara Bio Europe, France). Full-length cDNA (fl-cDNA ...
-
bioRxiv - Genomics 2023Quote: ... PCR3 products (final library) were purified with the Nucleospin Gel and PCR Cleanup kit (Takara, 740609) and eluted in 25 µL 70 °C buffer.
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted with a Bacterial RNA Extraction Kit and was immediately reverse-transcribed into cDNA using a PrimeScriptT™ RT-PCR Kit (TAKARA, Daliang, China). The common primer pair GSPilACF/GSPilACR was used to test genomic DNA contamination ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads are then subjected to three TE-TW washes and loaded into WTA PCR (100 μM Truseq PCR primer: IDT, CTACGACGCTCTTCCGATCT; 100 μM SMART PCR primer: IDT, AAGCAGTGGTATCAACGCAGAGT; Terra PCR mix: Takara Bio, 639284) with cycling conditions 98°C for 2min ...
-
bioRxiv - Neuroscience 2021Quote: The sgRNA sequences were amplified using Guide-it™ CRISPR Genome-Wide Library PCR Kit (Takara, 632651) and subjected to the high-throughput amplicon sequencing on NextSeq500 ...
-
bioRxiv - Immunology 2021Quote: ... using One Step TB Green(tm) PrimeScript(tm) RT-PCR Kit II (SYBR Green) (RR086B, TaKaRa, JAPAN). Relative copy number was determined by calculating the fold-change difference in the gene of interest relative to GAPTH ...
-
bioRxiv - Microbiology 2019Quote: ... the cDNA was purified and eluted in 20ul of elution buffer (NucleoSpin PCR Clean-up Kit, Clontech). The immunoglobulin PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Developmental Biology 2019Quote: ... The PCR products were extracted from agarose gel using MiniBEST Agarose Gel DNA Extraction Kit (Takara, Japan) based on manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... Then cDNA was synthesized according to the protocol of the RT-PCR kit (Takara; Kusatsu, Shiga, Japan) and used as templates for quantitative PCR ...
-
bioRxiv - Genetics 2021Quote: ... and One Step TB Green™ PrimeScript™ RT-PCR Kit II (SYBR Green) (TaKaRa RR086B, Japan).
-
bioRxiv - Neuroscience 2020Quote: ... The lentiviral genome copy number was calculated using the Clontech Lenti-X qRT-PCR Titration kit (Takara).
-
bioRxiv - Neuroscience 2020Quote: ... Physical viral titer was determined using either Lenti-X qRT-PCR Titration Kit (Takara, Mountain View, CA) or qPCR Lentivirus Titration Kit (Applied Biological Materials Inc. ...
-
bioRxiv - Neuroscience 2020Quote: ... The genome copy number was calculated using the Clontech Lenti-X qRT-PCR Titration kit (Takara Bio).
-
bioRxiv - Physiology 2021Quote: ... 1 μg RNA was used to synthesize first strand of cDNA using PrimeScriptTM RT-PCR Kit (TaKaRa). qPCR was conducted using PrimeScriptTMRT Master Mix (TaKaRa ...
-
bioRxiv - Plant Biology 2021Quote: ... Applied Biosystem StepOne real-time PCR system and SYBR Premix Ex Taq II kit (Takara, Dalian, China) were used for the qRT-PCR detection ...
-
bioRxiv - Microbiology 2022Quote: ... Two PCR products were inserted into the vector backbone using In-Fusion HD Cloning Kit (Takara Bio) to generate pLJM1-LTR-FT ...
-
bioRxiv - Plant Biology 2022Quote: ... The resulting cDNA was subjected to relative quantitative PCR using a SYBR Premix Ex TaqTM kit (TaKaRa) on a Roche LightCycler 480 real-time PCR machine ...
-
bioRxiv - Plant Biology 2022Quote: ... One microgram DNAse-treated RNA was converted to cDNA using Prime RT-PCR kit (Takara Bio Inc.). The qRT-PCR was performed on 11 selected DEGs containing DRE elements ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNA used for RT-PCR was synthesized using the PrimeScrip First-Strand cDNA Synthesis Kit (TaKaRa). RT-PCR cycling conditions were as follows ...
-
bioRxiv - Biochemistry 2020Quote: ... PCR fragments were sequenced and individual nanobodies were cloned using the In-Fusion cloning kit (Takara Bio) into a pET28a vector linearised by PCR with primers NbLib_pET28a_fwd (GGTGACCGTGAGCAGCCACCACCACCACCACCACTGAGATCCGGCTGCTAAC AAAGC ...
-
bioRxiv - Microbiology 2021Quote: ... Each RNA sample was reverse transcribed to 50 μl cDNA with RT-PCR Prime Script Kit (Takara). The cDNA (5 μl ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Reverse-transcription and cDNA amplification were performed with SMARTer® PCR cDNA Synthesis Kit (Clontech Laboratories, Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... qRT-PCR reactions were performed using a SYBR® Premix Ex Taq™ II Kit (TaKaRa, China) and a CFX96 real-time PCR detection system (BIO-RAD ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... qRT-PCR assays were carried out using the SYBR PrimeScript™ RT reagent Kit (TaKaRa, Kusatsu, Japan) following manufacturer‟s instructions and ABI 7500 Software v2.0.6 (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... SARS-COV-2 virus detection was performed using the One Step PrimeScript RT-PCR kit (TaKaRa, Japan) on the LightCycler 480 Real-Time PCR system (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was extracted and cDNA was synthesized by PCR (PrimeScript RT reagent kit with gDNA Eraser, TaKaRa). SaCas9 was amplified by PCR with Q5 High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Epidemiology 2021Quote: ... and SYBR Premix Ex Taq Kit for real-time PCR assay were purchased from Takara (Dalian, China). Monoclonal CD3-FITC/APC ...
-
bioRxiv - Genomics 2020Quote: cDNA was synthesized from parasite RNA using the SMARTer PCR cDNA synthesis kit (Takara, Mountain View, CA), which incorporates a poly(A ...
-
bioRxiv - Immunology 2020Quote: ... the DNA-amplicons for Illumina sequencing were generated by using Advantage 2 PCR Kit (TAKARA Bio Europe), employing a mTCRβ reverse primer and a Universal primer mix (UPM) ...
-
bioRxiv - Immunology 2022Quote: ... qRT-PCR was performed using the SYBRGreen included in the BacPAK™ qPCR titration kit (Clontech, USA) and a StepOnePlus™ Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting cDNA was subjected to relative quantitative PCR using the SYBR Premix Ex Taq kit (TaKaRa) on a Roche LightCycler 480 real-time PCR machine ...
-
bioRxiv - Molecular Biology 2022Quote: ... The in vitro assembly of PCR products was performed by using In-Fusion HD cloning kit (Takara). The assembled plasmids were amplified by transformation of Stellar Competent Cells (Takara ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg of total RNA was reversely transcribed into cDNA using the PimeScript RT-PCR kit (TAKARA) and analyzed by qPCR on LightCycler96 system (Roche ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA libraries were constructed using the immunoprecipitated mRNA and SMARTer PCR cDNA Synthesis Kit (Clontech, Cat: 634926), and sequenced on a HiSeq 2500 system (Illumina ...
-
bioRxiv - Microbiology 2023Quote: Amplification and detection were performed using the One Step PrimeScript™ RT-PCR Kit (RR064A, Takara Bio) with the following primers targeting the IAV M segment ...
-
bioRxiv - Microbiology 2023Quote: ... DNA in the supernatant was purified using the NucleoSpin Gel & PCR kit (Takara Bio, Kusatsu, Shiga, Japan). Sequencing libraries were then prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... First-strand cDNA synthesis was performed on 200ng RNA using the SMARTer PCR cDNA Synthesis Kit (Clontech) with specific oligo(dT ...
-
bioRxiv - Microbiology 2023Quote: ... using the Takara One Step TB Green PrimeScript™ RT-PCR kit (Takara Bio Inc., Shiga, JP) and the Roche LightCycler® 96 real-time PCR instrument (Roche Applied Science ...
-
bioRxiv - Microbiology 2023Quote: ... Resulting linear amplification products were pooled and purified using the NucleoSpin Gel and PCR Purification kit (Takara) with modified protocols for ssDNA (1:2 NTI buffer dilution) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA in the supernatant was purified using the NucleoSpin Gel & PCR kit (Takara Bio, Kusatsu, Shiga, Japan). Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche ...
-
bioRxiv - Genomics 2024Quote: ... except that an alternative oligo-dT primer from the SMARTer PCR cDNA Synthesis kit (Clontech Laboratories, Inc.), which also included a random 10mer sequence as a unique molecule identifier (UMI ...
-
bioRxiv - Neuroscience 2024Quote: ... The viral titer was measured using a Lenti-X qRT‒PCR Titration Kit (#631235, TaKaRa, Shiga, Japan).
-
bioRxiv - Neuroscience 2024Quote: ... cDNA synthesis was performed using a one-step PrimeScript RT-PCR kit (Takara Bio, Cat. RR057B, Japan) as per the manufacturer’s protocols ...
-
Autism genes converge on microtubule biology and RNA-binding proteins during excitatory neurogenesisbioRxiv - Systems Biology 2024Quote: ... Linearized pMK1334 vector was purified using NucleoSpin Gel and PCR clean-up kit (Takara Bio, Cat#740609.50). Top and bottom oligos of non-targeting and targeting sgRNAs were annealed ...
-
bioRxiv - Bioengineering 2024Quote: ... Viral genome number was quantified by real-time PCR with AAVpro Titration Kit Ver.2 (Takara, 6233) according to manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TCR beta chain libraries were generated using SMARTer Mouse TCR a/b Profiling Kit (Clontech). Samples were pooled to a final pool concentration of 4 nM and diluted to a final concentration of 13.5 pM ...