Labshake search
Citations for Takara Bio :
501 - 550 of 6565 citations for Mouse Direct PCR Kit For Genotyping since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... PCR was performed on a PCR thermal cycler (Takara, Tokyo, Japan) and real-time PCR was performed using QuantStudio 3 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Each PCR reaction was composed of CloneAmp HiFi PCR premix (Takara), 4ng of the plasmid template and 10-20ng of the primer pair mix ...
-
bioRxiv - Microbiology 2024Quote: ... PCR DNA amplifications were performed with CloneAmp HiFi PCR premix (Takara) using Primer-AP (5’ GACCACGCGTATCGATGTCGAC 3’ ...
-
bioRxiv - Plant Biology 2024Quote: ... All PCR reactions were performed using the PCR components from Takara bio Inc ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR templates were generated by PCR reaction with biotinylated primers using high fidelity ClonAmp HiFi PCR mix (Takara Inc.). A mixture of Cas9-mSA mRNA (75ng/μl) ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR templates were generated by PCR reaction with biotinylated primers using high fidelity ClonAmp HiFi PCR mix (Takara Inc.). A mixture of Cas9-mSA mRNA (75ng/ml) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1D libraries were prepared according to ONT protocol with 1D PCR Barcoding kit and full length non-directional sequencing was performed on PromethION instrument (using Clontech-SMART-Seq v4 Ultra Low Input kit). Basecalling was conducted using guppy version (v6.4.2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... ssDNA was purified using the Nucleospin Gel and PCR Clean-up kit (Machery-Nagel, distributed by Takara Bio USA) with buffer NTC used as recommended by the manufacturer ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR and cDNA synthesis were performed using SMARTer Ultra Low Input RNA Kit v3 following manufacturer’s protocol (Clontech). RNA isolated from 1000 cells was used as starting material ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR and cDNA synthesis were performed using SMARTer Ultra Low Input RNA Kit v3 following manufacturer’s protocol (Clontech). Single cells were used directly as starting material without RNA extraction to avoid extra loss of RNA ...
-
bioRxiv - Plant Biology 2020Quote: ... This was followed by a nested PCR and cloning of the products using the Mighty TA-cloning kit (TaKaRa). Twenty independent clones were randomly picked and sequenced.
-
bioRxiv - Microbiology 2021Quote: ... The PCR product of the assembled sequence was purified with a DNA Fragment Purification Kit (Takara, Dalian of China) and eluted with ddH2O ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized using a PrimeScript II High Fidelity One Step RT-PCR Kit (R026A, Takara Bio, Shiga, Japan), purified using a QIAquick PCR Purification Kit (QIAGEN ...
-
bioRxiv - Molecular Biology 2022Quote: ... qRT-PCR was carried out by using TB Green Premix Ex Taq II (Tli RNaseH Plus) kit (Takara, China) on ABI7500 Real-time system (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... Forty ng cDNA was used as templates for RT-PCR using SYBR® Premix Ex Taq kit (TaKaRa, #RR820A) using LightCycler 96 (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products of EgGLUT1-ss gene were recovered from Agarose Gel with Agarose Gel DNA Extraction Kit (Takara, Japan), and the amplified fragments were cloned into pMD19-T vector with Mighty ta-cloning Reagent Set for Prime STAR (Takara ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and then was transcribed to cDNA using the Clontech SMARTer PCR cDNA Synthesis Kit (Clontech, Mountain View, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Each sub-cloning was done by using the In-Fusion PCR cloning kit (Clontech Laboratories, Mountain View, CA, USA). Plasmids were integrated at the lys1 gene locus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Full length cDNA synthesis was done from polyA RNA using Clontech SMARTer PCR cDNA synthesis kit (Clontech Laboratories; (23)) ...
-
bioRxiv - Neuroscience 2020Quote: ... The mRNA expression was quantified using the SYBR green PCR kit (TaKaRa SYBRR Premix Ex Taq. II, Dalian, China) in a CFX96 Touch apparatus (Bio-Rad ...
-
bioRxiv - Genomics 2021Quote: ... The molar concentration of the library was determined by quantitative PCR (qPCR) using Library Quantification kit (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PCR products were cloned into the transcription vector pTB-207 [88] using the In-Fusion HD Cloning kit (Clontech) as described previously [89] ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PCR products were cloned into the transcription vector pTB-207 (69) using the In-Fusion HD Cloning kit (Clontech) as described previously (70) ...
-
bioRxiv - Microbiology 2019Quote: ... Purified PCR fragments were inserted into the pHEX2 plasmid (53) using the In-Fusion HD Cloning Plus kit (Clontech). Expression of the transgenes was controlled by the SAG1 promoter and selection was provided by the presence of the HPT selectable marker (50) ...
-
bioRxiv - Immunology 2020Quote: ... 1 μg of RNA per sample was used for first-strand synthesis by SMARTer PCR cDNA Synthesis Kit (Clontech). For quantitative RT-PCR (qPCR) ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Immunology 2020Quote: ... The RT products were amplified by nested PCR following the PrimeSTAR® HS DNA Polymerase kit protocol (Takara, Japan), with primers for TCRα and TCRβ ...
-
Guidelines for accurate genotyping of SARS-CoV-2 using amplicon-based sequencing of clinical samplesbioRxiv - Genomics 2020Quote: ... CDC-USA assay targeting gene N (IDT # 10006713) and One Step PrimeScript™ III RT-PCR Kit (TaKaRa #RR600A). Serial dilutions of reference material were prepared ranging from 1 to ~10M genome equivalents per reaction ...
-
bioRxiv - Evolutionary Biology 2020Quote: The water-in-oil droplets after the incubation step were diluted 10000-fold with 1 mM EDTA (pH 8.0) and subjected to RT-qPCR (PrimeScript One Step RT-PCR Kit (TaKaRa)) with primer 1 and 2 after heating at 95 °C for 5 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... They are routinely tested for contamination of mycoplasma by using PCR Micoplasma Test Kit (Takara Bio Inc., Shiga, Japan) and confirmed to be negative before performing experiments.
-
bioRxiv - Evolutionary Biology 2022Quote: ... The measurement was performed after diluting the droplets 100-fold with 1 mM EDTA (pH 8.0) and using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara).
-
bioRxiv - Microbiology 2022Quote: Amplified spike sequence was first gel-purified using NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then further purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2022Quote: ... Viral load was measured by RT-qPCR using One-Step SYBR® Primescript(tm) RT-PCR kit II (Takara). CT values from serum samples were used to calculate serum viral load according to regression equation built by a set of standard viral RNA extracted from dilutions of known titre virus preparation ...
-
bioRxiv - Plant Biology 2022Quote: ... aril and kernel tissues were pooled equally and cDNA was synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech). Size fractionation and selection (1-2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Start codon mutant constructs were generated by mutation PCR using the PrimeSTAR Mutagenesis Basal Kit (Takara Bio, Kusatsu, Japan) by replacing AUG with AAG at Met1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR amplified and subcloned into a pCG-strep expression construct using the In-Fusion® HD Cloning Kit (Takara) according to the manufacture’s instructions ...
-
bioRxiv - Genomics 2023Quote: Full-length cDNA was synthesized with 1.0 μg RNA from Diphasiastrum complanatum using the SMARTer PCR cDNA Synthesis kit (Clontech). The first-strand cDNA was amplified with PrimeSTAR GL DNA polymerase (Clontech ...
-
bioRxiv - Neuroscience 2023Quote: ... and the target bands at 14,438 bp were cut and purified with NucleoSpin® Gel and PCR Clean-Up kit (740609.250, Takara). The target amplicons were re-concentrated to > 300 ng/ µL with GlycoBlue™ Coprecipitant (AM9515 ...
-
bioRxiv - Cancer Biology 2023Quote: Real-time PCR was carried out using a TB Green Premix Ex Taq (Tli RNaseH Plus) kit (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... The 13 kb band was purified with gel purification kit (Takara Nucleospin® Gel and PCR Clean-up Midi). Eighty-two base pair single stranded oligos were designed according to the following structure:
-
bioRxiv - Immunology 2023Quote: ... The components of the master mix for the PCR and the PCR programs were set up according to the CloneAmp HIFI PCR protocol (Takara). All generated plasmids were sequenced before use (Eurofins Genomics).
-
bioRxiv - Developmental Biology 2024Quote: ... Quantitative PCR (qPCR) was performed on the CFX Connect Real-Time PCR Detection System using SYBR Green PCR Master Mix (TaKaRa). Primer pairs used were listed in Supplementary (Table S2) ...
-
bioRxiv - Plant Biology 2024Quote: ... The qRT-PCR analysis was performed using the ABI StepOne Plus PCR system and the SYBR Green Realtime PCR mix (Takara). The ubiquitin gene (Lj5g3v2060710 ...
-
bioRxiv - Neuroscience 2021Quote: ... Real time PCR was done via Real-time PCR equipment TP970 (Takara) and analyzed by Thermal Cycler Dice® Real Time System (Takara).
-
bioRxiv - Cell Biology 2021Quote: ... open reading frames were PCR-amplified using CloneAmp HiFi PCR Premix (Clontech), gel-purified using the Nucleospin® Gel and PCR Clean-Up kit (Macherey-Nagel) ...
-
bioRxiv - Cell Biology 2021Quote: ... Semi-quantitative PCR was performed with EmeraldAmp MAX PCR Master Mix (Takara). Primers for amlplication of Piezo1 and Gapdh genes were listed in our previous study [26].
-
bioRxiv - Developmental Biology 2019Quote: ... PCR for Gibson assembly was performed using CloneAmp HiFi PCR Premix (Clontech) and Q5 high-fidelity DNA polymerase (NEB) ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative PCR amplification was performed using SYBR Green PCR master mix (Takara) using 10ng of cDNA and 200nM of each specific primer on a 7500 Fast Real-PCR system (Applied Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... The PCR protocol was executed using the Sapphire PCR master mix (TAKARA) following manufacturer protocol ...
-
bioRxiv - Immunology 2022Quote: ... IGK and IGL 5’RACE AIRR-seq libraries were generated using the SMARTer Mouse BCR Profiling Kit (Takara Bio ...