Labshake search
Citations for Takara Bio :
1 - 50 of 1209 citations for Human METTL3 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... in 35mm plates with 0.5 μg of pLKO shRNA or pLVX expression plasmids (Takara), 0.35 μg pCMV-dR8.2 and 0.15 μg pCMV-VSVG ...
-
bioRxiv - Microbiology 2023Quote: ... pSIREN-shRNA-LucIRR and pSIREN-shRNA GAPDHHB were purchased from Clontech. pCDNA3.1 was purchased from Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: shRNA directed against human MAGI1 and AMOTL2 were constructed and cloned in the pSIREN-RetroQ vector (TaKaRa) according to the manufacturer’s conditions between BamHI and EcoRI cloning sites as previously described for other genes 75 ...
-
bioRxiv - Neuroscience 2019Quote: ... Neurons were transfected with 1.0 μg of scrambled or Rai1-shRNA-expressing plasmids with the CalPhos Transfection kit (ClonTech) or Lipofectamine 2000 (ThermoFisher Scientific ...
-
Heat Shock Factor 1 (HSF1) as a new tethering factor for ESR1 supporting its action in breast cancerbioRxiv - Cancer Biology 2021Quote: The shRNA target sequence for human HSF1 (NM_005526.4) was selected using the RNAi Target Sequence Selector (Clontech, Mountain View, CA, USA). The target sequences were ...
-
bioRxiv - Immunology 2022Quote: ... we expressed shRNA using SIREN-RetroQ (Clontech) gammaretroviral vector containing shRNA sequence targeting human TRIM5(Stremlau et al. ...
-
bioRxiv - Developmental Biology 2024Quote: Lentiviral particles were produced following transient transfection of the shRNA-pLKO.1 vector and packaging plasmids into Lenti-X cells (632180; Takara Bio USA) using Attractene (301005 ...
-
bioRxiv - Cell Biology 2023Quote: A cDNA fragment encoding human FAM53C was isolated by amplifying with nested PCR from human cDNA library plasmid (Takara). The oligonucleotide primer sequences used for the 1st PCR are 5′-CAAAGTGTGCAAGTCAAATCCTGG-3′ (5′ upstream ...
-
bioRxiv - Biochemistry 2020Quote: ... ADAR1 and PCBP2 cDNA were cloned from human thymus plasmid cDNA library (Clontech) using standard PCR techniques and then subcloned into indicated vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... The human fimbrin sequence was cloned into a pEGFP-C1 plasmid (Clontech; 6084-1). The human ezrin sequence was cloned into a pEGFP-N1 (Clontech ...
-
bioRxiv - Neuroscience 2023Quote: ... GFP-tagged human tauKQ and tauP301L were expressed from the pEGFP-C1 plasmid (Clontech). Expression of mApple or GFP in cultured neurons was done using pGW1 mApple and pEGFP-C1 plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... Human CXCR4 was cloned into the pAcGFPm-N1 plasmid (Clontech Laboratories, Palo Alto, CA), as described (20).
-
bioRxiv - Cell Biology 2023Quote: shRNA constructs were engineered on a pSIREN retroviral vector (Clontech). To deplete the endogenous expression of BIN1 ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviruses for shRNA transduction were generated in HEK293T cells (Takara). 8.4 µg of the vector of interest ...
-
bioRxiv - Cell Biology 2020Quote: ... CHO-K1 cells were transfected with ACP-human IR plasmid using Xfect transfection reagent (Takara). 1 day after transfection ...
-
bioRxiv - Immunology 2021Quote: ... and cDNA encoding human full-length MuSK was cloned into pIRES2-EGFP plasmid vector (Clontech). AChR and MuSK vectors were kindly provided by Drs ...
-
bioRxiv - Genetics 2022Quote: ... Lentiviral shRNA particles were prepared with Lenti-X 293T cells (Takara) and MISSION pLKO.1 plasmids (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The plasmid GFP-GT198 contained full-length human GT198 in a pEGFP-C3 vector (Clontech, 6082-1). HeLa cells transfected with GFP-GT198 (green ...
-
bioRxiv - Immunology 2023Quote: Wt or mutated human (h)ALPK1 cDNA constructs were cloned into the pCMV-myc plasmid (Takara Bio Inc) and were all siRNA resistant against the hALPK1 siRNA (s37074 ...
-
bioRxiv - Genomics 2019Quote: ... transduced with concentrated shRNA-expressing lentiviruses harvested from LentiX-293T cells (Takara Bio; 632180), and cultured in BD Matrigel Matrix High Concentration (BD Biosciences ...
-
Heat Shock Factor 1 (HSF1) as a new tethering factor for ESR1 supporting its action in breast cancerbioRxiv - Cancer Biology 2021Quote: ... Sense and antisense oligonucleotides were annealed and inserted into the pLVX-shRNA vector (Clontech) at BamHI/EcoRI site ...
-
bioRxiv - Cell Biology 2022Quote: ... A cassette containing the pre-shRNA sequence was inserted into pBAsi-mU6 (Takara Bio). The target sequences of each shRNA are as follows ...
-
bioRxiv - Cancer Biology 2023Quote: Oligonucleotides were synthesized and cloned into the pSIREN-RetroQ retroviral shRNA expression vector (Clontech). Then pSIREN-RetroQ-Sirt7 and the negative control vector (pSIREN-RetroQ ...
-
bioRxiv - Microbiology 2021Quote: For human ectopic expression plasmids: Full length cDNA for each gene was amplified from a HeLa cDNA library (Takara Bio) and inserted into a pCDNA expression plasmid modified with either a C-terminal HA or N-terminal V5 tag under the human cytomegalovirus (CMV ...
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Developmental Biology 2021Quote: The short hairpin RNA (shRNA)-expressing lentivirus vectors were constructed using pLVX-shRNA1 vector (Clontech). PRMT1-shRNA_#3–targeting sequence is GTGTTCCAGTATCTCTGATTA ...
-
bioRxiv - Neuroscience 2020Quote: Bacterial expression plasmids encoding mouse and human WT-α-synuclein in the inducible pRK172 backbone were transformed into BL21-CodonPlus (DE3) cells (Clontech). Cell pellets were lysed in 0.75M NaCl ...
-
bioRxiv - Neuroscience 2020Quote: ... or cotransfected with IQSEC3 KD and shRNA-resistant myc-IQSEC3 using a CalPhos Transfection Kit (Takara) at DIV8 and immunostained at DIV14 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... purified plasmids with NucleoSpin Plasmid EasyPure (TaKaRa), and sequenced one plasmid for each NSP and MA gene from each of the 218 larval samples ...
-
bioRxiv - Immunology 2022Quote: ... Retrovirus vectors carrying shRNA sequences were constructed by inserting annealed oligonucleotides into a pSIN-siU6 vector (Takara) between BamHI and ClaI sites ...
-
bioRxiv - Biochemistry 2021Quote: A cDNA fragment encoding full-length human EGFR (UniProt accession no. P00533) was cloned into the pEGFP-N1 plasmid (Clontech, Mountain View, CA). To facilitate affinity purification ...
-
bioRxiv - Cancer Biology 2022Quote: CPT1a knockdown cell lines were generated using the shRNA-expressing lentiviral pLKO-shRNA2 vector (No. PT4052-5; Clontech), with a puromycin selection cassette ...
-
bioRxiv - Neuroscience 2023Quote: The Hes5.3-GFP plasmid derive from pEGFP-C1 plasmid (Clontech). The fragment bounded by the AseI and NheI restriction sites was deleted from pEGFP-C1 and the upstream sequences of Hes5.3 (1960 bp in length ...
-
bioRxiv - Cancer Biology 2019Quote: Knockdown vectors expressing shRNAs were constructed by subcloning an annealed oligonucleotide into the pBAsi-hU6-Pur vector (TaKaRa Bio). Oligonucleotide sequences encoding the shRNA hairpin are shown below.
-
bioRxiv - Neuroscience 2023Quote: ... eGFP plasmid (Clontech) at 5 ng/μL and pOCTmCherry at 1 μg/mL (Tradewell et al ...
-
bioRxiv - Genomics 2022Quote: ... Individual colonies had their plasmids extracted using NucleoSpin Plasmid (Takara Bio) and Sanger sequenced to verify successful ligation with no sequence errors ...
-
bioRxiv - Cell Biology 2020Quote: All GFP plasmids used were cloned into pEGFP-N1 plasmid (Clontech): pEGFP-N1 ...
-
bioRxiv - Cell Biology 2020Quote: ... HeLa cells were transfected with control (scramble) or NUP153-specific shRNA vectors along with FLAG-hNUP153 expression vector using Xfect transfection reagent (Clontech) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... including a puromycin resistance cassette and a tet-responsive element for expression of shRNAs was established according to a publicly available protocol (46) using In-Fusion HD Cloning Kit (Clontech) (Supplementary Table 3) ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression of shRNA targeting and knocking-down Eklf was induced by the addition of 2 µg/ml of doxycycline (Clontech) for 96 hr ...
-
bioRxiv - Cell Biology 2019Quote: Human MPS1 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: Human CDC20 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The constructed plasmids then were purified using nucleospin plasmid-transfection grade (TAKARA) and transfected into piezo1-deficient N2A cells (Sugisawa et al. ...
-
bioRxiv - Genetics 2019Quote: ... Plasmid pEGFP-N1 (Clontech), expressing EGFP under the control of a CMV promoter ...
-
bioRxiv - Developmental Biology 2021Quote: ... in plasmid pGBKT7 (Clontech), and as a prey to the activation domain of the GAL4 transcription factor (GAL4-AD ...
-
bioRxiv - Neuroscience 2022Quote: ... and pHelper plasmid (TAKARA). The supernatants were purified and concentrated in phosphate-buffered saline (PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... pHelper plasmid (Takara Bio) and AAV transfer plasmids using TransIT-VirusGEN Transfection reagent (Mirus) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmid pEYFP-N1 (Clontech) was used as control ...
-
bioRxiv - Physiology 2019Quote: Human TMEM206 was cloned from cDNA obtained from a human brain cDNA library (Clontech) using the following primers:
-
bioRxiv - Microbiology 2021Quote: ... Plasmid DNA was isolated using the FastGene Plasmid Mini Kit (Nippon Genetics, Tokyo, Japan) or NucleoSpin Plasmid EasyPure Kit (Takara Bio). The REase NdeI was employed for the linearization of plasmid DNAs ...