Labshake search
Citations for Takara Bio :
251 - 300 of 5440 citations for Cow Casein Kinase II Subunit Alpha 2 CSNK2A2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... An anti-histidine antibody was used for ELISAs as positive control (Takara, catalog # 631212).
-
bioRxiv - Evolutionary Biology 2020Quote: PCR amplification was carried out using the Advantage GC 2 PCR Kit (Clontech Catalog #639119), and cloning was carried out using standard procedures (primer sequences are listed below).
-
bioRxiv - Genomics 2021Quote: ... and 2) the reduction of the amount of PrimeStar GXL DNA Polymerase kit (Takara, Japan) from 2 ul to 1 ul per reaction.
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 infected patients were confirmed using a RT-qPCR kit (TaKaRa, Dalian, China) as recommended by the China CDC.
-
bioRxiv - Microbiology 2023Quote: ... 2×SYBR Green PCR Mastermix (RR820A) and reverse transcription kit (RR047A) were purchased from TAKARA company ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was amplified by 15 cycles of PCR using the Advantage 2 PCR Kit (Clontech) with template switching custom oligo (TableS6) ...
-
bioRxiv - Immunology 2019Quote: ... the Sma I site of pT7-pOV8 was changed to Bgl II site with ten mer Bgl II linker (GCAGATCTCG, TAKARA) to produce pT7-Bgl II-pOV8 ...
-
bioRxiv - Genomics 2019Quote: The 90-μL preparation volume for PCR contains 1X Advantage 2 PCR Buffer [not short amplicon (SA)](10X, Clontech, 639206, Advantage® 2 PCR Kit), 0.4-mM dNTP Mix (50X/10 mM ...
-
bioRxiv - Molecular Biology 2019Quote: ... with SYBR premix Ex Taq II (Clontech RR820B). ChIP DNA was purified with Qiagen PCR purification kits ...
-
bioRxiv - Molecular Biology 2019Quote: ... with SYBR premix Ex Taq II (Clontech RR820B). Standard curves were generated for each primer pair using a serial dilution of cDNA ...
-
bioRxiv - Cell Biology 2021Quote: ... and 0.5 µl Reverse Transcriptase Superscript II (Takara). Reverse transcription was carried out in the thermocycler at 42 °C for 90 min ...
-
bioRxiv - Plant Biology 2020Quote: ... and SYBR Premix Ex Taq™ II (Takara) was used (Qanmber et al. ...
-
bioRxiv - Microbiology 2020Quote: ... with SYBR Premix Ex TaqTM II (TaKaRa, RR820A) and the primers are shown in S3 Table ...
-
bioRxiv - Developmental Biology 2022Quote: ... SYBR Green Premix Ex Taq II (Takara, RR820A) was used to analyze the quantitative RT-PCR (RT-qPCR ...
-
bioRxiv - Cell Biology 2020Quote: ... and SYBR Premix Ex Taq II (Takara, Japan).
-
bioRxiv - Systems Biology 2019Quote: ... with SYBR Premix Ex Taq™ II (Takara). Comparative analysis was performed between the genes of interest normalized by the house keeping genes GAPDH and ACTB ...
-
bioRxiv - Plant Biology 2019Quote: ... and SYBR Premix Ex Taq II (TaKaRa Bio), in a CFX96 Real-Time System (Bio-Rad Laboratories) ...
-
bioRxiv - Cell Biology 2019Quote: ... with SYBR Premix Ex Taq™ II (Takara). Comparative analysis was performed for the genes of interest ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... followed by staining with SYBR Green II (Takara). The fluorescent intensities of the parasitic RNA bands were quantified and the concentrations were determined based on the standard curve drawn with the dilution series of the standard parasitic RNA bands.
-
The logic of native enhancer-promoter compatibility and cell-type-specific gene expression variationbioRxiv - Genomics 2022Quote: ... with SYBR® Premix EX TaqTM II (Takara) and primers listed in the table (99-112) ...
-
bioRxiv - Genetics 2022Quote: ... cDNA was synthesized using Prime Script II (TAKARA) following the supplier’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... the SYBR Premix Ex Taq II (Takara Bio) was used for quantifying the specific transcripts and analyzed with QuantStudio 6 Flex (Life Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: ... using SYBR® Premix Ex TaqTM II (Takara) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... using TB Green Premix Ex TaqTM II (TaKaRa) with the following primers ...
-
bioRxiv - Pathology 2023Quote: ... with SYBR Premix Ex TaqTM II (TaKaRa, Japan). The RT-qPCR was performed for at least three biological replicates under the following conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... Using TB Green PreMix Ex Tap II (Takara) and specific primers ...
-
bioRxiv - Cell Biology 2023Quote: ... using TB Green Premix ExTaq II (Takara Bio) with the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... the cDNAs were reverse-transcribed from 5 µg of total RNA with the PrimeScript™ II 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China). Real time PCR (qPCR ...
-
bioRxiv - Cell Biology 2022Quote: ... and Foxa3 were obtained by reverse transcription PCR using a template RNA extracted from a C57BL/6J liver using a PrimeScript™ II 1st strand cDNA Synthesis Kit (TAKARA Bio, Japan). The coding sequences of the primers used are listed in Table S3 ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized from total RNA of each culture sample using the PrimeScript II 1st strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan) with random hexamers to yield a total volume of 20 μL ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from LNs and used for RT-qPCR using a Prime Script™ II Strand cDNA Synthesis kit (Takara, Dalian, China), in accordance with the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... the first-strand cDNA was synthesized from 1 μg total RNA using PrimeScript™ II 1st Strand cDNA Synthesis Kit (Takara, Beijing, China) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Plant Biology 2021Quote: ... after which it was used as the template for synthesizing cDNA using the PrimeScript™ II 1st strand cDNA Synthesis Kit (Takara Bio, Beijing, China). The full-length ZmCd1 cDNA was amplified by PCR using Phanta Max Super-Fidelity DNA Polymerase (Vazyme Biotech) ...
-
bioRxiv - Biophysics 2021Quote: ... SYBR Premix Ex Taq II (Takara, Otsu, Shiga, Japan) on StepOnePlus Real Time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: ... using the SYBR premix ExTaq™ II (Takara, Japan) in 96-well optical reaction Roche plates ...
-
bioRxiv - Molecular Biology 2019Quote: ... with SYBR Premix Ex Taq II (TaKaRa, Dailian, China). The reaction was carried out at a final volume of 15.0 μL ...
-
bioRxiv - Neuroscience 2020Quote: ... with SYBR Premix Ex Taq TM II (Takara Bio). The specificity of amplicons was examined by melting curve analysis and agarose gel electrophoresis ...
-
bioRxiv - Plant Biology 2021Quote: ... and TB Green Premix Ex Taq II (Takara, Japan). The following PCR conditions were used ...
-
bioRxiv - Immunology 2022Quote: ... using SYBR Premix Ex Taq II mix (TaKaRa Bio) as described [8] ...
-
bioRxiv - Plant Biology 2022Quote: ... 10 μL of SYBR Premix Ex TaqTM II (Takara), and 0.4μL of reference dye ...
-
Enterohepatic Transcription Factor CREB3L3 Protects Atherosclerosis via SREBP Competitive InhibitionbioRxiv - Physiology 2020Quote: ... and TB Green Premix EX Taq II (TAKARA Bio) (Fujimoto et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... and TB Green Premix Ex Taq II (Takara Bio). Gene expression levels were measured using TaqMan® gene expression assay kit (Applied Biosystems ...