Labshake search
Citations for Takara Bio :
501 - 550 of 5440 citations for Cow Casein Kinase II Subunit Alpha 2 CSNK2A2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Transcript expressions were determined by qRT-PCR using SYBR Premix Ex Taq II (TaKaRa) and the QuantStudioTM real-time PCR instrument (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA was amplified by qRT-PCR with SYBR Premix Ex Taq II (RR820A, Takara) in ABI 7300 thermal cycler (Applied Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... Real-time PCR was performed using SYBR Premix Ex Taq II (TliRNaseH Plus) (TaKaRa). The level of GmSALT3 transcript was normalised using the control gene GmUKN1 (Hu et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... qPCR was performed in triplicates with the SYBR Premix Taq II master mix (Takara) and specific primers on the LightCycler 96 (Roche) ...
-
bioRxiv - Pathology 2019Quote: ... Quantitative PCR (qPCR) was performed using TB GreenTM Premix Ex TaqTM II (TaKaRa, RR820A) on QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... The mammalian expression plasmid pHEK293 Ultra Expression Vector II (Takara Bio Inc., Shiga, Japan) was also inserted with the N or GPC ORF at the BamHI site of multicloning sites ...
-
bioRxiv - Immunology 2021Quote: ... Real-time PCR were performed with the SYBR Premix Ex Taq II (TAKARA#RR820A) in a LightCycler480 real-time PCR system ...
-
bioRxiv - Genomics 2019Quote: ... 9.0 μL of 3 SMART™ CDS Primer II A (12 M, Clontech, 634936), and 1.4 μL of Loading Reagent (20X ...
-
bioRxiv - Genomics 2022Quote: Whole bladder protein lysate was obtained by homogenizing bladder tissue using Biomasher II (TaKaRa) in ice-cold RIPA buffer with the protease inhibitor (ThermoFisher Scientific) ...
-
bioRxiv - Genetics 2022Quote: ... RT-qPCR was performed using TB Green Premix ExTaq II (Tli RNAseH Plus) (TAKARA) with Thermal Cycler Dice ® Real Time System III (one cycle of 95°C for 30 s followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s) ...
-
bioRxiv - Plant Biology 2022Quote: ... qRT-PCR was performed with SYBR Premix Ex Taq™ II (Takara Bio Inc.) or THUNDERBIRD SYBR qPCR Mix (Toyobo ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative RT-PCR were carried out using TB Green Premix Ex Taq II (Takara). 1 μL of diluted cDNA was used for each reaction in a final volume of 15 μL ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μL reaction volume of TB Green® Premix Ex TaqTM II (TaKara, Japan), which included 40ng fecal DNA ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time PCR was performed using TB Green Premix Ex Taq II (Takara, Japan) and ViiA7 Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: qRT-PCR was performed using SYBR® Premix Ex Taq™ II (Takara Biotechnology) and CFX96 Connect Real-Time system (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers and templates were mixed with TB Green Premix Ex Taq II (Takara Bio). mRNA levels were then normalized to that of Gapdh and calculated using the comparative Ct method ...
-
bioRxiv - Cell Biology 2022Quote: ... on a Thermal Cycler Dice Real Time System II MRQ (TP960; TaKaRa, Kusatsu, Japan) or Thermal Cycler Dice Real Time System (TP800 ...
-
bioRxiv - Biochemistry 2023Quote: ... qRT-PCR was carried out using SYBR Premi qRT-PCR ExTaq™ II (Takara) and analyzed on a Bio-Rad CFX96 real time PCR cycler (BioRad ...
-
bioRxiv - Molecular Biology 2024Quote: The quantitative RT-PCR (qRT-PCR) was performed with SYBRGreen II (Takara, Dalian, China). The 7500 system (Applied Biosystems ...
-
bioRxiv - Immunology 2024Quote: ... and quantitative PCR (qPCR) was performed with SYBR Premix Ex Taq II (TaKaRa-Bio) using a LightCycler (Roche ...
-
bioRxiv - Plant Biology 2024Quote: ... following the manufacturer’s instructions with TB Green Premix Ex Taq II (Takara, Shiga, Japan) and the primers listed in Supplemental Table S7.
-
bioRxiv - Neuroscience 2024Quote: ... qRT-PCR was carried out with TB Green Premix Ex Taq II (Takara: RR82LR) using gene-specific primers ...
-
bioRxiv - Microbiology 2024Quote: ... TB Green Premix Ex Taq II (Tli RNaseH Plus) (Takara Bio Inc., Shiga, Japan) and gene-specific primers at a concentration of 1 μM were used ...
-
bioRxiv - Cancer Biology 2024Quote: ... qPCR was performed in triplicates with the SYBR Premix Taq II master mix (Takara) and specific primers on the LightCycler 96 (Roche) ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... was performed by quantitative real-time polymerase chain reaction (PCR) using the AAVpro™ Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Plant Biology 2020Quote: ... and used for qPCR using TB green Premix Ex Taq II (Takara Bio, CA, USA) on Bio-Rad CFX 96 C1000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time PCR was performed using TB Green Premix Ex Taq™ II (Takara Bio) on a StepOnePlus™ real-time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-qPCR was performed with TB Green Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa) on the StepOnePlus Real-time PCR System (Applied Biosystems ...
-
bioRxiv - Plant Biology 2019Quote: ... Real-time PCR (qRT-PCR) was determined by using SYBR Premix Ex Taq II (TaKaRa) and performed on ABI Stepone real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2019Quote: ... Results were quantified using real-time PCR with SYBR premix Ex Taq II solution (TaKaRa). Chromatin immunoprecipitation (ChIP ...
-
bioRxiv - Cell Biology 2019Quote: ... qPCR was conducted with SYBR Premix Ex-Taq II (Tli RNase H Plus, TaKaRa, #RR820A) per manufacturer’s instructions on a QuantstudioTM3 instrument (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... and TB Green™ Premix Ex Taq™ II (Tli RNase H Plus) (RR820L, Takara) with two repeats for each PCR ...
-
bioRxiv - Pathology 2022Quote: ... PCR reactions were conducted with SYBR qPCR Premix Ex Taq II Tli RNaseH+ (TAKRR820W,Takara). Primer pairs are listed in Table S2 ...
-
bioRxiv - Biochemistry 2021Quote: ... qRT-PCR analysis was performed using the SYBR® Premix Ex Taq™ II (Takara) on Applied Biosystems 7500 Real-Time PCR System ...
-
bioRxiv - Molecular Biology 2022Quote: 7.5 ng cDNA were mixed with 2X TB green Premix Ex Taq II (Takara, RR820B), 10μM forward and reverse primers ...
-
bioRxiv - Bioengineering 2019Quote: ... qPCR was performed with SYBR Premix Ex Taq™ II (Tli RNaseH Plus) (TAKARA, Japan) according to the manufacturer’s instructions on a CFX96 touch qPCR system (Bio-Rad ...
-
bioRxiv - Biochemistry 2019Quote: ... qPCR reactions were carried out using SYBR® Premix Ex Taq™ II Supermix (Takara) in a CFX384 real-time PCR system (Bio-Rad) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 10 ng of cDNA was analyzed using SYBR Premix Ex Taq II (TaKaRa Biotechnology) on a CFX Connect TM Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2021Quote: ... real-time qPCR was performed using SYBR premix ex-Taq-ii (Takara Bio Inc., Japan) and a PCR detection system (Bio-Rad ...
-
bioRxiv - Molecular Biology 2023Quote: ... and SYBR Premix Ex Taq II (Tli RNase H Plus) (Takara Bio INC, Kusatsu, Japan). All reactions were performed in at least three biological replicates ...
-
bioRxiv - Genetics 2023Quote: ... Quantitative real-time PCR was performed with TB Green Premix Ex TaqTM II (Takara, RR820A) in a StepOne real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time PCR was performed using SYBR® Premix Ex Taq™ II (Takara Bio) and the Mx3000P Real-time quantitative PCR system (Agilent Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative RT-PCR was performed using Premix Ex Taq II (Takara Bio Inc., Shiga, Japan) on a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2024Quote: ... qPCR was performed with Thermal Cycler Dice Real-time System II (Takara Bio, Shiga, Japan) and Luna Universal qPCR Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... The cDNA was amplified using SYBR Premix Ex Taq II (Tli RNase H Plus; Takara) in a CFX96 Touch real-time PCR detection system (Bio-Rad ...