Labshake search
Citations for Takara Bio :
101 - 150 of 798 citations for 7 S 17 S dihydroxy 8 E 10 Z 13 Z 15 E 19 Z Docosapentaenoic Acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Hippocampal neurons were transfected on DIV11-13 using CalPhos Mammalian Transfection kit (Takara) per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP (JL-8, Clontech, #632381). Secondary antibodies used included ...
-
bioRxiv - Cancer Biology 2023Quote: ... GFP (632381,JL-8, Takara), p-VASP (3111 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 µl Cloning Enhancer (Takara) was added to 20 µl of the PCR product and incubated for 15 min at 37 °C on a thermocycler ...
-
bioRxiv - Microbiology 2024Quote: ... Monoclonal Antibody (JL-8) (Clontech). Anti-mouse IgG was used as a secondary antibody.
-
bioRxiv - Immunology 2019Quote: ... GFP (JL-8; RRID:AB_10013427) from Takara Bio (Kusatsu ...
-
bioRxiv - Neuroscience 2024Quote: ... GFP (1:1,000, JL-8, Clontech), GABARAP/Atg8a (1:2,000 ...
-
bioRxiv - Bioengineering 2023Quote: ... Monoclonal Antibody (JL-8) (632381; Clontech) in 1:2,000 dilution ...
-
bioRxiv - Cancer Biology 2022Quote: SV40-MES-13 cells were lysed with xTractor Buffer Kit (CLONTECH Laboratories, Inc., CA, USA). Protein specimens were quantified through BCA method and electrophoresed through 10% SDS-PAGE gels ...
-
bioRxiv - Systems Biology 2019Quote: MCF-7 Tet-On cells were purchased from Clontech and maintained as previously described (Liu et al. ...
-
bioRxiv - Microbiology 2021Quote: ... were PCR-amplified from genomic DNA with primers 19-22 and cloned into the vector pRS29 using ligation-independent cloning (In-Fusion, Clontech). A guide RNA with sequence AATAACGATATTAAATGTAA was cloned into a modified pAIO vector called pCasG85 using primers 23 and 24 ...
-
bioRxiv - Genomics 2019Quote: ... we used the miRNA quantifications from all brain libraries with all starting amounts using both batches (total of 99 libraries, 19 for the Clontech, NEXTflex ...
-
bioRxiv - Plant Biology 2023Quote: The nucleotide sequence (around 500 bp long) specific to the NlCA coding region was cloned into the pMD 19-T vector (TAKARA). The double-stranded RNA was synthesized through PCR amplification by using the Mega script T7 High Yield RNA Transcription Kit (Vazyme ...
-
bioRxiv - Biochemistry 2021Quote: ... Living Colors (GFP) (JL-8, 632380, Clontech), α-Tubulin (DM1A ...
-
bioRxiv - Developmental Biology 2019Quote: ... A monoclonal GFP antibody (JL-8; Clontech) and a monoclonal HA antibody (sc-7392 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-GFP clone JL-8 (Takara 632381) 0.5 µg/mL ...
-
bioRxiv - Genetics 2022Quote: ... 8 μL dNTPs (Clontech Takara Cat# 4030), 5μL DMSO (Sigma Aldrich Cat# D9170-5VL) ...
-
bioRxiv - Genetics 2022Quote: ... 8 μL dNTPs (Clontech Takara Cat# 4030), 5μL DMSO (Sigma Aldrich Cat# D9170-5VL) ...
-
bioRxiv - Cell Biology 2023Quote: ... mAb clone JL-8 (632381) from Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (Clone JL-8; Clontech) at 1:1,000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse GFP (1:200, JL-8, Clontech) gp anti-Verm (Wang et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... mAb clone JL-8 (632381) from Takara Bio.
-
bioRxiv - Biophysics 2019Quote: ... D40A mutation and deletion of C-terminal 10 amino acids were introduced into pET15-sfGFP-minD by using the PrimeSTAR Max mutagenesis protocol (TaKaRa, Shiga, Japan). Similarly ...
-
bioRxiv - Microbiology 2021Quote: ... using 15 μl of elution buffer (Takara). Library quantification was performed with a Qubit 3 Fluorometer with dsDNA Hs Assay kit (Life Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: Gene-specific target sequences as well as a heterologous fragment from Mus musculus (Muslta) used for double-stranded RNA (dsRNA) synthesis were amplified and cloned into pMD™ 19-T Vector (Takara). Templates used for single-stranded RNA were amplified with primers that incorporated with the T7 promoter sequence (S4 Table) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and fragments were cloned into the pSAM2-Puro lentiviral vector 13 by In-Fusion HD Cloning (Takara).
-
bioRxiv - Genetics 2021Quote: 1:500 mouse anti-GFP (Takara, JL-8)
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-GFP (JL-8 clone, Takara Bio) or mouse anti-alpha-tubulin (Sigma) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 8 μL of RNase-free water (Takara). The experiment of each sample was performed more than three times on a newly prepared printing chip and PCR substrate ...
-
bioRxiv - Plant Biology 2022Quote: ... anti-GFP monoclonal antibody JL-8 (632381, Clontech) was used at 1/3000 ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse Anti-GFP (1:1000; JL-8, Clontech). Blots were washed three times with PBST and probed with secondary antibodies diluted in PBS with 1% milk and 1% BSA for one hour at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and transferred into 8 µL lysis buffer (Clontech SMARTer Ultra Low Input RNA Kit for Sequencing - v3) ...
-
bioRxiv - Microbiology 2023Quote: ... GFP tag (JL-8 monoclonal antibody from Takara), and mCherry (polyclonal antibody from Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... nine DNA fragments encoding the partial genome of SARS-CoV-2 (hCoV-19/Japan/TY-WK-521/2020) were amplified by PCR using PrimeSTAR GXL DNA polymerase (Takara, Cat# R050A). A linker fragment encoding the hepatitis delta virus ribozyme ...
-
bioRxiv - Molecular Biology 2024Quote: ... HepG2-NTCP and Huh-7 cells with RNAi plus (TaKaRa, Japan) according to the manufacture’s protocol ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... All PCR reactions were performed in 24 μl volumes with 13 μl ExTaq HS polymerase (Takara Bio Inc.), 1 μL each forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: The open reading frames of 19 LD-associated proteins were amplified from RIB40 genomic DNA with PrimeSTAR® HS DNA Polymerase (TaKaRa, Otsu, Japan) for high-fidelity PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 U and 8 U of MNase (TaKaRa 2910A) in MNase digestion buffer containing 20 mM Tris–HCl (pH 8.0) ...
-
bioRxiv - Cell Biology 2022Quote: ... monoclonal anti-GFP JL-8 (1:1000, Clontech 632380), polyclonal rabbit anti-RP2 (1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: Primary antibodies against GFP (Clontech, JL-8; 1:5000), G-6-PDH (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary Antibodies: anti-GFP (JL-8; Clontech, 1:1000), anti-Flag (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... a monoclonal anti-GFP (Living Colors JL-8, Clontech), or a monoclonal anti-β-actin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse α-GFP JL-8 (cat. no. 632381, Takara) used at a concentration of 1:2,000 ...
-
bioRxiv - Neuroscience 2024Quote: ... Protamine sulfate (Final concentration: 8 μg/ml, Takara Bio) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... phospho-specific mutant constitutively active NFATC4 17 was also cloned into the doxycycline-inducible Tet-One expression system (Clontech) to create an inducible and constitutive NFATC4 (IcNFATC4 ...
-
bioRxiv - Microbiology 2023Quote: ... HEK-293/17 cell media were harvested and concentrated overnight with a Lenti-X concentrator (Clontech, Mountain View, CA) according to the manufacturer’s protocol and resuspended in 10-fold less media volume prior to concentration.
-
bioRxiv - Molecular Biology 2023Quote: ... and then used as the template to synthesize double strand cDNA amplicons by PCR (optimal 17 – 21 cycles) using Advantage 2 PCR kit according to the manufacturer’s specifications (Clontech). cDNA was purified using NucleoSpin Gel and PCR Clean-up kit (Takara Bio) ...
-
bioRxiv - Microbiology 2023Quote: ... sequence was replaced by that of virR (encoding amino-acids 1 to 164) or virRsol (encoding amino-acids 42 to 164) by In-Fusion HD cloning (Takara). PCR fragments were amplified using appropriate primer pairs (Table S1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 million Lenti-X HEK-293T cells (Takara Bio, cat. no. 632180) were seeded in 9 mL DMEM (Gibco ...