Labshake search
Citations for Takara Bio :
401 - 450 of 798 citations for 7 S 17 S dihydroxy 8 E 10 Z 13 Z 15 E 19 Z Docosapentaenoic Acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... 9 ul from each samples were directly used for cDNA amplification (15 cycles of LD PCR, using the SMART-Seq v4 Ultra Low Input RNA kit for sequencing (Takara Bio, #634898) and the SeqAmp DNA Polymerase (Takara Bio #638509) ...
-
bioRxiv - Immunology 2020Quote: ... The locus containing exons 11 through 15 of Copa was amplified off RP24-64H24 with FseI flanking ends and ligated into pEasyFloxDTA with Infusion recombination (Takara Bio USA) to form the 3’ homology arm.
-
bioRxiv - Cell Biology 2019Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... The forward primer contained a Kozak sequence and both primers contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). To make pmCherry-N1-Gal3 ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Immunology 2020Quote: ... Cells were counted and seeded at 3 million cells in 1 mL of media with 2x hIL-2 into each well of a 6 well plate that was coated with 15 µg/mL of RetroNectin (Takara, Cat# T100A) for 3 hours at room temperature and subsequently washed with 1x PBS ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Total RNA was extracted from the whole bodies of a pool of 15 AM-treated larvae using the TaKaRa MiniBEST Universal RNA Extraction Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... for 30 min at 37°C in a moisture chamber followed by an incubation with anti-GFP (1:100 in PBSA) antibody at 4°C for 72 h (Takara 632381/JL-8)) ...
-
bioRxiv - Cell Biology 2020Quote: ... transfected with relevant siRNA were seeded on to 8–well chamber slides and treated with 1 μM Sheild1 (632189, Clontech Laboratories UK Ltd) and 1 μM 4–hydroxytamoxifen (4–OHT ...
-
bioRxiv - Genetics 2019Quote: ... and performed the 2nd round of PCR to attach to the libraries adaptor and index sequences for the NGS analysis for 8 cycles again with Tks Gflex™ DNA Polymerase (Takara, Cat#R060A). The DNA sequences of the adaptor/index primers are listed in Table S6 ...
-
bioRxiv - Genomics 2023Quote: ... 1 μl of 5’ linker (10 μM) was ligated with 10 μl of Mighty mix (DNA Ligation Kit
, catalog num. 6023, Takara) to 4 μl of the sample coming from the previous step ... -
bioRxiv - Cell Biology 2019Quote: ... 10 μM a/c heterodimerizer (Clontech, cat#635057) was added to the medium (the same volume of EtOH was added to the control group) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... supplemented with 10% FBS (fetal bovine serum, Clontech) and 1% P/S (Penicillin-Streptomycin ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 10% tetracycline-free FBS (631106, Clontech, [Conda Laboratories ...
-
bioRxiv - Plant Biology 2021Quote: ... using 10 μL SYBR Premix Ex Taq (Takara), 2 μL of 2-fold diluted cDNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 10% tetracycline-free FBS (Takara #631107) and penicillin-streptomycin (Gibco #15140122).
-
MEK inhibitor resistance in lung cancer cells associated with addiction to sustained ERK suppressionbioRxiv - Cancer Biology 2022Quote: ... supplemented with 10% tetracycline-free FBS (Clontech, 631101) and Pen/Strep (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... and RNA inhibitor (TaKaRa 2313; 10 units/reaction), Oligo-dT (IDT ...
-
bioRxiv - Cancer Biology 2021Quote: ... and maintained in 10% tetracycline-free FBS (Clontech).
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 10% fetal bovine serum (FBS) (Takara), 1% MEM Non-Essential Amino Acids Solution (NEAA 100X ...
-
bioRxiv - Neuroscience 2019Quote: ... supplemented with 10% foetal bovine serum (ClonTech, 631107) and 1% L-glutamine (Sigma ...
-
bioRxiv - Synthetic Biology 2020Quote: ... supplemented with 10% FBS (fetal bovine serum, Clontech) and 1% P/S (Penicillin-Streptomycin ...
-
bioRxiv - Synthetic Biology 2020Quote: ... supplemented with 10% Tet System Approved FBS (ClonTech), 100 U/ml penicillin ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with 10% foetal bovine serum (ClonTech, 631107), 1% L-glutamine (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 10% fetal bovine serum (FBS, Clontech) in a humidified atmosphere of 5% CO2 at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 10% fetal bovine serum (FBS, Clontech) in a humidified atmosphere of 5% CO2 at 37°C and transfected after 24 hours with the pX459-gRNADicerNterm-Cas9-2A-Puro plasmid and the Leftarm-FlagHAGFP-RightarmDICER donor plasmids at the ratio of 1 to 1 (6 micrograms plasmids in total ...
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with 10% Tet system approved FBS (Clontech) and 100 µg/ml geneticin ...
-
bioRxiv - Genomics 2021Quote: ... 11 µL of 10 mM dNTP (Takara, #639125), 13.75 µL of ultra-pure water and 2.75 µL of RNase Inhibitor (Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 10% fetal bovine serum (FBS) (Takara) in a humidified atmosphere of 5% CO2 at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 μL of SYBR Premix Ex-Taq (TaKaRa), and 7.2 μL of H2O ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10% FBS (fetal bovine serum, Clontech) and 1% P/S (Penicillin-Streptomycin ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10% FBS (fetal bovine serum, Clontech) and 1% P/S (Penicillin-Streptomycin ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 10% FBS (Clontech, Mountain View, CA), 50 U/mL penicillin ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 10% fetal bovine serum (FBS) (Clontech) and antibiotics ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 10% fetal bovine serum (FBS) (Clontech), human interleukin-2 (IL-2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 10% fetal bovine serum (FBS, Clontech) in a humidified atmosphere with 5% CO2 at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... and 10 μg/ml RetroNectin (Takara, Cat# T100A). Then ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 10% fetal bovine serum (FBS, Clontech) and 50 μg/ml gentamicin (Life Technologies) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... which contains a six-amino acid His-tag for the creation of a N-terminal fusion using the In-Fusion HD cloning kit (Clontech, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... two to three amino acids in GFP-SP-BAP were replaced by alanine for each construct using the CloneAmp HiFi PCR Premix (Takara Bio) according to the manufacturer.
-
bioRxiv - Biochemistry 2021Quote: ... Add 25 mL 200 g/L glucose and 25 mL 20 g/L amino acid drop-out mix (Clontech. Inc., Japan) solution to prepare the medium] ...
-
bioRxiv - Neuroscience 2022Quote: ... Pak1 fragment (amino acids 270–521) was PCR-amplified from pCMV6M-Pak1 and subcloned into pCold-Pros2 vector (Takara Bio Inc.) to generate pCold-Pros2-Pak1cat ...
-
bioRxiv - Neuroscience 2023Quote: ... lysates were centrifuged at 31,000 x g for 45 min at 4°C and the supernatant was mixed with nickel-nitrilotriacetic acid (Ni-NTA) beads (Takara, 635653) at 4°C for 2 h ...
-
bioRxiv - Genomics 2021Quote: ... 10 ng of cfDNA was dephosphorylated in a 10-μL reaction containing 2.5 μL of 10× TACS buffer and 1 μL of shrimp alkaline phosphatase (Takara Bio Inc.) at 37 °C for 15 min ...
-
bioRxiv - Microbiology 2022Quote: ... RNA samples with sufficient material (10 pg–10 ng) were passed to whole-transcriptome library preparation using the SMART-Seq v4 PLUS Kit (Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RNA samples with sufficient material (10 pg–10 ng) were passed to whole-transcriptome library preparation using the SMART-Seq v4 PLUS Kit (Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... the fragments of the pcAGGS/pcDNA3.1 vector and each target gene were amplified with a 15 bp homologous arm and were then fused using the In-Fusion HD Enzyme (Clontech, Felicia, CA, USA). To create the pcAGGS-huANP32B-Δ216/190/165 plasmids ...