Labshake search
Citations for Takara Bio :
4701 - 4750 of 6263 citations for Triiodothyronine T3 ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The freshly extracted plasmids were transformed into yeast strain Y2H gold by using a yeast transformation kit (TaKaRa, Beijing, China) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... were subjected to RNA-seq library preparation using SMARTer Stranded Total RNA-Seq Kit – Pico Input Mammalian (Cat. No. 635005, TAKARA). All the libraries were analysed through a Bioanalyzer for quality control ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was generated from 200ng of RNA using PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio; Cat. No. RR047A) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2022Quote: ... A CVB3 genome encoding a NanoLuc luciferase (NLuc) reporter was generated using the In-Fusion HD Cloning Kit (Takara, 638909). NanoLuc luciferase was cloned from the pLenti6.2-Nanoluc-ccdB ...
-
bioRxiv - Microbiology 2022Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara-Bio) and the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... as described previously.15 Alkaline phosphatase (ALP) staining was also performed for pluripotency characterization using TRACP & ALP double-stain Kit (Takara) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Transient transfection was performed with the use of HilyMax liposome transfection reagent (Dojindo Laboratories) or CalPhos Mammalian Transfection Kit (Clontech). Unless otherwise noted ...
-
bioRxiv - Plant Biology 2024Quote: ... complete sequences of the three genomic segments of AV2 were obtained by 5ʹ- and 3ʹ-RACE with the SMARTer RACE cDNA amplification kit (Clontech) using infected Nicotiana occidentalis leaf material (DSMZ ...
-
bioRxiv - Systems Biology 2024Quote: ... Strand specific RNA-seq libraries were then constructed using the SMARTer Stranded RNA-seq kit (634485; Clontech, Kusatsu, Shiga, Japan), according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA encoding ZP3 was restored from the mouse ovarian tissue by RT-PCR using PrimeScript RT Reagent Kit (Takara, RR037). Two PCR amplicons including the 5′ region of the TECTA-ZP and the transmembrane domain (TMD ...
-
bioRxiv - Cell Biology 2024Quote: RNA sequencing libraries of rRNA-depleted nuclear RNA or polyA RNA were prepared with SMARTer Stranded Total RNA-Seq Kit v2 (Takara) according to the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was prepared and cDNA was synthesized with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara) and ran the Agilent Tapestation to assess cDNA product ...
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting double-stranded cDNA’s were further processed to DNA sequencing libraries using ThruPLEX DNA-seq 12S Kit (R400428, Clontech Laboratories). Libraries were size-selected by gel purification for an average size of 350bp ...
-
bioRxiv - Immunology 2023Quote: ... Each gene fragment was PCR-amplified and cloned into a pcDNA 3.1 vector by using the In-Fusion HD cloning kit (Takara Bio). Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were generated using SMARTer Human TCR a/b Profiling Kit v2 (Takara Bio USA, San Jose, California, USA). Briefly ...
-
bioRxiv - Plant Biology 2024Quote: ... and introduced into linearized (with KpnI) pCGEN (Motteram et al. 2011) using the In-Fusion HD Cloning Kit (Takara Bio). The resulting vectors ...
-
bioRxiv - Molecular Biology 2024Quote: ... the annealed oligos were ligated into the digested lentiCRISPRv2 backbone using the DNA ligation kit (Mighty Mix) (Takara, Cat# 6023). Afterward ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were then reverse transcribed employing a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan). Nested PCR conditions were as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A, Takara). Quantitative primers were designed based on the gene sequences by Sangon Biotech ...
-
bioRxiv - Neuroscience 2024Quote: ... and then the tip of the recording electrode was broken into the nested PCR reagent system (Prime ScriptTm RT reagent Kit with QDNA Eraser, Cat: RR0471, Takara), and a cDNA synthesis kit was used to synthesize cDNA following the manufacturer’s protocol (PrimeScriptm II1st Strand cDNA Synthesis Kit) ...
-
bioRxiv - Microbiology 2024Quote: ... Total RNA was extracted using RNApure FFPE Kit (CWBIO, Jiangsu, China) and then treated with DNase I (TaKaRa, Kyoto, Japan) to remove DNA contaminants ...
-
bioRxiv - Immunology 2024Quote: RNA libraries of esophageal epithelial tissue biopsies and organoids were prepared using SMART-Seq HT Ultra Low Input RNA kit (Clontech) and NEBNext Ultra II RNA Library Prep Kit for Illumina ...
-
bioRxiv - Immunology 2024Quote: ... and quantified using bulk RNA-seq (Psomagen) after construction of Illumina sequencing libraries using the SMARTer Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian (Takara). Noise from low-expression transcripts was filtered ...
-
bioRxiv - Microbiology 2023Quote: ... the pLVX-G9R+A1L-puromycin or pLVX-G9R+A1L-blasticidin plasmids were transfected into 293T cells using the Lenti-X Packaging Single Shots kit (631275, TaKaRa). Lentiviral supernatants were harvested 48 hours post-transfection and filtered through a 0.45 μm membrane (SLHV033RB ...
-
bioRxiv - Microbiology 2024Quote: ... All 3 fragments were then ligated into pUC18T-mini-Tn7T digested with EcoRI and XmaI using the infusion kit (Takara). The deletion of bspD was complemented by cloning of a 2160 bp long sequence encoding bspD and its upstream region including eipA and its 5’ non-coding region harboring the CtrA-controlled promoter (22 ...
-
bioRxiv - Cell Biology 2024Quote: ... the Sar1 genome template was first amplified from HeLa genomic DNA with following primers (CCGCTCTAGAACTAGTACCCAAATGAGCTCTGGC, CGGTATCGATAAGCTTGCATCAGTATTAAATACACATG) and cloned into pBSIISK(-) by In-Fusion HD cloning Kit (TAKARA). Next ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries from input and IP samples were prepared using the SMARTer Pico Input Mammalian v2 RNA-seq kit (Takara) and sequenced as SE50 runs on an Illumina HiSeq4000.
-
bioRxiv - Molecular Biology 2024Quote: ... except that raw read processing by Cutadapt had to be adapted to different library construction method (SMARTer smRNA-Seq Kit, TAKARA). In particular ...
-
bioRxiv - Plant Biology 2024Quote: Rapid amplification of cDNA ends (5’ RACE) was used to determine the transcripts of the RB gene using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the protocol ...
-
bioRxiv - Neuroscience 2023Quote: RNAs were extracted from cultured cells and tissues using RNA extraction kit and reverse transcribed into cDNAs (both from TAKARA) according manufacturers’ instructions ...
-
bioRxiv - Cell Biology 2024Quote: A PCR product containing the Human ORF for DDX3X was obtained directly from RNA using the Primescript High Fidelity RT-PCR kit from Takara. The PCR primers introduced BamHI and NotI sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... Three nanograms of total RNA were used for amplification using the SMART-Seq V4 Ultra Low Input RNA kit (Clontech) according to the manufacturer’s recommendations (10 PCR cycles were performed) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Reporter plasmid libraries were made by cloning amplified ATAC fragments into AgeI-HF- and SalI-HF-linearized pSTARR-seq plasmid using InFusion HD cloning kit (Takara) and then propagated in MegaX DH10B T1R electrocompetent bacteria ...
-
bioRxiv - Developmental Biology 2024Quote: ... Library construction started from 4.9ng of RNA per sample made using the SMARTer Stranded Total RNA-seq Kit v3-Pico Input Mammalian (Takara; 634486). The quality of libraries was checked with the with the High Sensitivity DNA Reagents Kit (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... 1 ng RNA was used as input to generate cDNA with the SMART-Seq v4 Ultra Low Input RNA Kit (Takara), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Digests were run on a 0.8% agarose-TAE gel and full-length plasmids were extracted with the Nucleospin PCR and Gel Cleanup Kit (Takara, 740609). A LR reaction was performed with 150 ng entry library and 150 ng pDEST_HC_Rec_Bxb_v2 ...
-
bioRxiv - Bioengineering 2024Quote: ... Appropriate colonies were grown and the recombinant bacmid DNA was extracted using the NucleoBond Xtra Midi plasmid purification kit (TAKARA). The fifth instar silkworm larvae ...
-
bioRxiv - Biochemistry 2024Quote: ... The RNA was quantified and 1.5 μg of RNA was used to prepare cDNA using PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio) and random hexamer primer ...
-
bioRxiv - Cell Biology 2024Quote: ... One to six nanograms of RNA were used to generate a cDNA library using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara). Samples were sequenced with a NextSeq 500 (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... The annealed fragment was ligated into NheI/EcoRI-digested pWALIUM20 (#1472, DGRC) vector using DNA Ligation Kit
(#6023, TaKaRa). -
bioRxiv - Microbiology 2023Quote: ... Reverse transcription reaction was set up using the cleaned-up RNA (1.6µg) using PrimeScript™ RT reagent Kit (Takara, Japan). The RT reaction was carried out with buffering temperature at 25 ºC for 2 mins ...
-
bioRxiv - Immunology 2022Quote: FACS sorted cells (5,000 cells) were subjected to cDNA synthesis using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Immunology 2022Quote: FACS sorted cells (5,000 cells) were subjected to cDNA synthesis using SMART-Seq v4 Ultra Low Input RNA Kit for sequencing (Takara/Clontech). Barcoded libraries were generated by the Nextera XT DNA Library Preparation kit (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... n = 3 pools of 250 GFP+ cells were collected for direct RNA-Seq library preparation using the SMART-Seq HT PLUS kit (Takara), according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... lentiviral constructs pCMV-VSV-G and pCMV-dR8.2 dvpr 98 were transfected in HEK293T cells by the calcium-phosphate method (CalPhos Mammalian Transfection Kit, Takara, 631312) for virus production ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was extracted from PAMs using the TRIzol reagent and was reverse transcribed using the PrimeScript RT kit (TaKaRa). qPCR was performed using the PowerUp SYBR Green Master Mix on the ABI StepOnePlus system ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were ligated into pACT7_SC14 (HBB minigene reporter as previously described (31) using homology-based cloning technology (In-Fusion HD Cloning kit, Takara Bio). Following sequence verification ...
-
bioRxiv - Plant Biology 2023Quote: ... The tissue was fixed for 30 min and the immunoprecipitation performed using a SEP3-specific antibody followed by library preparation using ThruPLEX DNA-Seq Kit (Takara) and deep sequencing65 ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was then used for library preparation using the SMARTer small RNA (smRNA)-seq kit for Illumina (Takara Bio) according to the manufacturer’s instructions ...