Labshake search
Citations for Takara Bio :
4601 - 4650 of 6263 citations for Triiodothyronine T3 ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... as well as the left and right homology arms were assembled and cloned into SmaI-digested pBluescriptII SK(-) in a single enzymatic reaction using the In-Fusion Cloning Kit (TAKARA). gRNA vectors were constructed in pDCC690 ...
-
bioRxiv - Plant Biology 2021Quote: Double-stranded RNA (dsRNA) of GFP and CHS were synthesized using the in vitro Transcription T7 Kit (Takara, Ohtsu, Japan). Briefly ...
-
bioRxiv - Genetics 2021Quote: ... Quantitative PCR was performed using KAPA SYBR Fast qPCR Kits (Nippon Genetics, Japan) on Dice Real Time System Single Thermal Cycler (Takara) or CFX96 Real- Time System (BioRad ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... a DNA fragment library of 220 bp insert size was prepared using the PrepX ILM 32i DNA Library Kit (Takara), and mate-pair libraries of 3 kb insert size were prepared using the Nextera Mate Pair Sample Preparation Kit (cat ...
-
bioRxiv - Neuroscience 2020Quote: ... the RNA sample was diluted into 140 ng/μL and purified with the Primescript TM RT regent kit (Takara, RR047). cDNA was generated using SYBR® Premix Ex Taq™ II kit (Takara ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA synthesis from the total RNA was carried out using the PrimeScriptTM High Fidelity RT-PCR Kit (TaKaRa, Shiga, Japan) using an oligo dT primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... The specific PCR products were gel purified by using the DNA Gel Extraction Kit (Axygen, USA) and cloned to the pMD-18 vector system (Takara), and then sequenced by the Shanghai Sangon Company.
-
bioRxiv - Developmental Biology 2020Quote: ... DNA libraries were generated using Takara’s SMART-Seq v4 Low Input RNA Kit for Sequencing (Takara, Mountain View, California, USA) for cDNA synthesis and the Illumina NexteraXT DNA Library Preparation (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... Libraries were simultaneously prepared using Takara’s SMARTer Stranded Total-RNA Pico v2 library preparation kit following manufacturer’s protocol (Takara cat#634412). Prepared libraries were sequenced on Illumina Nextseq500 at 2×75cycles.
-
bioRxiv - Pathology 2021Quote: ... First-strand complementary DNA was synthesized from total RNA using a PrimeScriptTM RT reagent kit with gDNA Eraser (Takara, China). Then ...
-
bioRxiv - Biochemistry 2021Quote: ... falciparum cDNA followed by Ligation Independent Cloning into HindIII/KpnI-cleaved plasmid pOPIN F (82) using the In-Fusion HD EcoDry Cloning Kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated from 2 ng total RNA using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories) and amplified using 11 cycles of PCR ...
-
bioRxiv - Developmental Biology 2021Quote: The reverse-stranded total RNA-seq libraries (Fig. 4 and Fig. S2A) were prepared using the SMARTer-Seq Stranded kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Mutations with multiple amino acids were introduced by ligating inverse PCR-amplified backbone with mutations bearing DNA oligonucleotides via the In-Fusion Cloning Kit (ClonTech). All mutants were confirmed by Sanger sequencing.
-
bioRxiv - Cell Biology 2021Quote: ... 1 × 106 HEK293T cells were transfected with 4 μg donor and 2.5 μg pX330 Cas9 plasmid (CalPhos™ Mammalian Transfection kit, Clontech). After 72 h ...
-
bioRxiv - Cell Biology 2021Quote: ... One microgramme of total RNA was reverse-transcribed using a One Step PrimeScript™ RT-PCR Kit (Takara, Liaoning, China) with a thermocycler ...
-
bioRxiv - Cell Biology 2021Quote: ... The srpHemo promoter fragment was inserted at the Stu1 restriction site of the PCasper4 plasmid52 using the infusion kit from Clontech and the following infusion primer pair ...
-
bioRxiv - Genomics 2020Quote: ... We synthesized and amplified complementary DNA (cDNA) from each tissue using the SmartSeq v4 Ultra Low-input RNA kit (Clontech) from 1 ng of input RNA with 17 cycles of PCR ...
-
bioRxiv - Genetics 2020Quote: ... Three overlapping MTM1 cDNAs were amplified using three pairs of cDNA primers from Tosch et al(Tosch et al. 2010) using the PrimeSTAR GxL kit (Takara). Primers are F1/R1 (ATGGCTTCTGCATCAACTTC / TGGAATTCGATTTCGGGAC ...
-
bioRxiv - Cancer Biology 2021Quote: ... by subcloning it into the multiple cloning site of the pKT2/CAGXSP vector19 through recombination cloning (In-Fusion HD Cloning Kit, Clontech). For the EV reporter ...
-
bioRxiv - Microbiology 2021Quote: ... the pLVX-ORF3-E plasmid was transfected into HEK-293T cells using the Lenti-X Packaging Single Shots kit (Takara). Lentiviral supernatants were harvested at 72 h post-transfection and filtered through a 0.22 μM membrane (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... retroviral packaging construct pTG5349 and a reporter pCCLSIN.cPPT.hPGK.GFP.WPRE into HEK 293T cells by calcium-phosphate method (Calphos Mammalian Transfection kit, Clontech as per manufacturer’s instructions). Cells were seeded on 60×15mm dish a day before transfection to achieve 70 – 80% confluency ...
-
bioRxiv - Molecular Biology 2021Quote: Genes of interest were amplified from genomic DNA of W303-1A and cloned into the respective vector using the In-Fusion HD cloning kit (Clontech). Mutations and deletions were introduced by oligonucleotide-directed site-specific mutagenesis.
-
bioRxiv - Microbiology 2020Quote: ... All elements of the PbDCIII plasmid were amplified by PCR using standard PCR conditions (using the CloneAmp HiFi PCR premix) and sequentially ligated into the SphI-SalI restriction sites of a pUC18 vector (In-Fusion HD Cloning Kit, Clontech). The resulting plasmid sequence was verified by Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2020Quote: ... All elements of the DiCre plasmid were amplified by PCR using standard PCR conditions (using the CloneAmp HiFi PCR premix) and sequentially ligated (In-Fusion HD Cloning Kit, Clontech) into an acceptor plasmid containing a TgDHFR/TS cassette flanked by two LoxP sites ...
-
bioRxiv - Microbiology 2020Quote: ... The double-stranded oligonucleotides were end-labeled with [α-32P]-dCTP with the Random Primer Labeling Kit (Takara, Dalian, China). The binding reaction (28 μl ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were originally obtained from ATCC (except MAGIC5 cells) and routinely tested negative for mycoplasma contamination (PCR Mycoplasma Detection kit, Takara).
-
bioRxiv - Microbiology 2020Quote: ... The infectious titer of lentivirus was determined by a Lenti-X™ qRT-PCR Titration Kit (Clontech, Mountain View, CA).
-
bioRxiv - Microbiology 2020Quote: ... Removal of genomic DNA and synthesis of cDNA were performed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Japan). The concentration of purified RNA was quantified on a Nanodrop ND-1000 spectophotometer (NanoDrop Technologies ...
-
bioRxiv - Immunology 2021Quote: ... Cells were sorted directly into lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara) and frozen until all samples were ready for simultaneous processing ...
-
bioRxiv - Immunology 2021Quote: ... Cell lysis was quantified by measuring the amount of intracellular LDH release into the cell culture supernatant (TaKaRa LDH cytotoxicity detection kit; Clontech). Percentage PI uptake and LDH release were calculated relative to 100 % cell lysis in untreated control sample.
-
bioRxiv - Molecular Biology 2021Quote: ... Mutations with multiple amino acids were introduced by ligating inverse PCR-amplified backbone with mutations bearing DNA oligonucleotides via the In-Fusion Cloning Kit (ClonTech). All mutants were confirmed by Sanger sequencing.
-
bioRxiv - Immunology 2020Quote: ... The infectious units per mL was determined using the AdenoX Rapid Titer kit according to the manufacturer’s instructions (Clontech Laboratories).
-
bioRxiv - Immunology 2021Quote: ... This amplicon was cloned into a pLEX lentiviral backbone cut with BamHI and XhoI using the InFusion HD kit (Takara). pLEX-ACE2 was co-transfected with psPAX2 and pMD2.G into 293FT cells for lentiviral packaging ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the 5’ end was used and the 3’ of TciALDO cDNA was obtained by 3’ RACE (SMARTer RACE cDNA Amplification Kit, Clontech) using T ...
-
bioRxiv - Immunology 2020Quote: Total RNA was added directly to lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara), and reverse transcription was performed followed by PCR amplification to generate full-length amplified cDNA ...
-
bioRxiv - Immunology 2020Quote: RNA-seq libraries were prepared from sorted proximal SI IEC or from sorted SI TCRαβ+CD8αα+ IET by the Sequencing Core at La Jolla Institute for Immunology using the SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (TaKaRa)(Picelli et al. ...
-
bioRxiv - Microbiology 2021Quote: ... three inserts were amplified by PCR and sequentially inserted in two steps using the In-Fusion HD Cloning Kit (Clontech). In the first step ...
-
bioRxiv - Microbiology 2021Quote: ... These fragments were cloned at the XmnI site of pPsfiAcherry and pPsfiA*cherry respectively using the In-Fusion HD cloning kit (Clontech). All constructs were verified by PCR and sequencing ...
-
Neutralizing activity of broadly neutralizing anti-HIV-1 antibodies against primary African isolatesbioRxiv - Immunology 2020Quote: ... and the presence of p24 in the culture supernatant was quantified by the Lenti-X p24 Rapid Titer kit (Clontech) after 7 ...
-
bioRxiv - Immunology 2020Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) using primers with specificity to IgM ...
-
bioRxiv - Microbiology 2021Quote: ... were added to the lysates of single parasites and libraries were prepared using SMART-Seq v.4 Ultra Low Input RNA Kit (Takara) using a quarter of the reagent volumes recommended by the manufacturer ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA (0.5ng/mL) was added to lysis buffer from the SMART-seq V4 Ultra Low Input RNA kit for Sequencing (Takara), and reverse transcription was performed followed by PCR amplification to generate full-length amplified cDNA ...
-
bioRxiv - Immunology 2020Quote: ... RNA treated with DNase and the cDNAs were synthesized with PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, #RP047A). Samples without reverse transcriptase were also added as control ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cloned into into modified pJet:attB:mCherry vector (Roberts et al., 2014) containing phiC31 attB site and mCherry reporter using In-Fusion HD Cloning Kit (TaKaRa/Clontech) according to the manufacture instructions ...
-
bioRxiv - Genetics 2019Quote: ... luteus isolates was used in a genome walking procedure using the Universal GenomeWalker™ kit (Clontech, Mountain View, California, US) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Libraries from 4-cell embryos were also prepared using 18-30 nt gel purified RNA using the SMARTer smRNA-Seq Kit (Clontech) and NEXTflex-Small-RNA-Seq (New England Biolabs ...
-
bioRxiv - Genomics 2019Quote: ... The 48-μL preparation volume for reverse transcription (RT) contains 1X SMARTer Kit 5X First-Strand Buffer (5X; Clontech, 634936), 2.5-mM SMARTer Kit Dithiothreitol (100 mM ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The concentrations of the host and the parasitic RNAs were measured by RT-qPCR (PrimeScript One Step RT-PCR Kit (TaKaRa)) with sequence-specific primers (Supplementary text).
-
bioRxiv - Genetics 2020Quote: ... The products obtained were subsequently subjected to semi-nested PCR with a LA Taq Hot Start polymerase kit (TaKaRa Biotechnology). The first round of amplification was performed with primers ...