Labshake search
Citations for Takara Bio :
4451 - 4500 of 5541 citations for Galactose Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The ORF of zebrafish rpl36 (ENSDARG00000100588) was amplified by RT-PCR and cloned into pCS2+ via EcoRI/XhoI restriction sites using DNA Ligation Kit (TAKARA). The ORF of zebrafish znf598 (ENSDARG00000014945 ...
-
bioRxiv - Plant Biology 2023Quote: ... and converted to cDNA using the SMART-Seq® v4 Ultra® Low Input RNA Kit for Sequencing (Takara Bio), following the manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2022Quote: ... which was then cloned into the Aor51HI site in pUGW2 35S 97 using the In-Fusion cloning kit (TaKaRa Bio). The 2.5-kb HindIII-SacI fragment in the resulting plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... The resultant fragments were cloned into the EcoRI and NotI recognition sites of pCAG neo using HD Cloning Kit (TaKaRa). All recombinant proteins were fused with a his-tag and expression was confirmed using an anti-his tag antibody.
-
bioRxiv - Microbiology 2023Quote: ... and were quantified by real-time RT-PCR using One Step TB Green PrimeScript RT-PCR Kit II (Perfect Real Time) (TaKaRa) and QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNAs were prepared from 1 ng of total RNA using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa) according to the manufacturer guidelines for cDNA synthesis and amplification ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was acquired by using the Prime Script RT reagent kit with genomic DNA (gDNA) eraser (TaKaRa, Beijing, China). The SYBR Premix Ex Taq II kit (TaKaRa ...
-
bioRxiv - Neuroscience 2023Quote: 10 ng RNA from each worm sample was used as input for cDNA synthesis using a SMART-Seq v4 Ultra Low Input RNA kit (Takara). Sequencing libraries were prepared from 500 pg of cDNA with a Nextera XT DNA Library Prep kit (Illumina) ...
-
bioRxiv - Neuroscience 2022Quote: ... the BamHI/BsrGI digested PCR product was ligated to the linearized backbone using the DNA Ligation Kit - Mighty Mix (TaKaRa) resulting pPB-ef1a-NLS-EGFP-T2A-puro.
-
bioRxiv - Neuroscience 2022Quote: ... These guides were individually cloned into pAAV-U6-sasgRNA-CMV-mCherry-WPREpA at the BstXI and XhoI restriction enzyme sites using the In-Fusion HD cloning kit (Clontech). rAAV vectors were generated using similar plasmids and cloning methods as was referenced in (Matharu et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The titer of harvested lentivirus was established using the Lenti-X RT-qPCR Titration Kit (Takara Bio, Cat. no. 631235). A representative calibration plot and LV tittering of pAIO is added as Supplementary data S4.
-
bioRxiv - Molecular Biology 2022Quote: ... Probes for FLuc (500 bp) were generated using gel-purified PCR amplicons containing GFP sequence and a BcaBEST Labeling kit (Takara) and [α-32P]-dCTP (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Amplified mTurbo and FLAG-cyp40 fragments were introduced into XbaI site of pUASp-K10-attB vector using In-Fusion HD Cloning Kit (Takara). To generate UASp-mTurbo-FLAG-cyp40deltaTPR ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was then purified and resuspended with SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio Inc., Shiga, Japan) according to the manufacturer’s instructions for mRNA amplification using 5’ template switching polymerase chain reaction (PCR) ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting mutant BAC was electroporated into NEB 10-beta cells and purified using the Nucleobond BAC 100 kit (Takara).
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries for RNA sequencing were prepared from 5 ng RNA/sample using the SMARTer Stranded Total RNA-Seq Kit v2 -Pico Input Mammalian (Takara) according to the manufacturer’s instructions using 12 PCR cycles for amplification ...
-
bioRxiv - Molecular Biology 2022Quote: ... The freshly extracted plasmids were transformed into yeast strain Y2H gold by using a yeast transformation kit (TaKaRa, Beijing, China) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... were subjected to RNA-seq library preparation using SMARTer Stranded Total RNA-Seq Kit – Pico Input Mammalian (Cat. No. 635005, TAKARA). All the libraries were analysed through a Bioanalyzer for quality control ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was generated from 200ng of RNA using PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio; Cat. No. RR047A) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2022Quote: ... A CVB3 genome encoding a NanoLuc luciferase (NLuc) reporter was generated using the In-Fusion HD Cloning Kit (Takara, 638909). NanoLuc luciferase was cloned from the pLenti6.2-Nanoluc-ccdB ...
-
bioRxiv - Microbiology 2022Quote: ... was used as the template for real-time RT-PCR performed according to the manufacturer’s protocol using the One Step TB Green PrimeScript PLUS RT-PCR kit (Takara-Bio) and the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... 1 ng of total RNA was pre-amplified with the SMARTer Ultra Low Input kit v4 (Clontech, Mountain View, CA) per manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... as described previously.15 Alkaline phosphatase (ALP) staining was also performed for pluripotency characterization using TRACP & ALP double-stain Kit (Takara) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Transient transfection was performed with the use of HilyMax liposome transfection reagent (Dojindo Laboratories) or CalPhos Mammalian Transfection Kit (Clontech). Unless otherwise noted ...
-
bioRxiv - Plant Biology 2024Quote: ... complete sequences of the three genomic segments of AV2 were obtained by 5ʹ- and 3ʹ-RACE with the SMARTer RACE cDNA amplification kit (Clontech) using infected Nicotiana occidentalis leaf material (DSMZ ...
-
bioRxiv - Systems Biology 2024Quote: ... Strand specific RNA-seq libraries were then constructed using the SMARTer Stranded RNA-seq kit (634485; Clontech, Kusatsu, Shiga, Japan), according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of total RNA was reverse transcribed into complementary DNA (cDNA) using PrimeScript™ RT Reagent Kit (Takara, RR047B). Amplification of cDNA product was performed using specific primers with the TB Green® Premix Ex Taq™ II (Takara ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA encoding ZP3 was restored from the mouse ovarian tissue by RT-PCR using PrimeScript RT Reagent Kit (Takara, RR037). Two PCR amplicons including the 5′ region of the TECTA-ZP and the transmembrane domain (TMD ...
-
bioRxiv - Cell Biology 2024Quote: RNA sequencing libraries of rRNA-depleted nuclear RNA or polyA RNA were prepared with SMARTer Stranded Total RNA-Seq Kit v2 (Takara) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR product was run on a 1% agarose gel at 85 V for 35 min and gel extracted using the Nucleospin Gel Extraction Kit (Takara). We then used PCR with KOD Polymerase 2x Mastermix (Millipore Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was prepared and cDNA was synthesized with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara) and ran the Agilent Tapestation to assess cDNA product ...
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting double-stranded cDNA’s were further processed to DNA sequencing libraries using ThruPLEX DNA-seq 12S Kit (R400428, Clontech Laboratories). Libraries were size-selected by gel purification for an average size of 350bp ...
-
bioRxiv - Immunology 2023Quote: ... Each gene fragment was PCR-amplified and cloned into a pcDNA 3.1 vector by using the In-Fusion HD cloning kit (Takara Bio). Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were generated using SMARTer Human TCR a/b Profiling Kit v2 (Takara Bio USA, San Jose, California, USA). Briefly ...
-
bioRxiv - Plant Biology 2024Quote: ... and introduced into linearized (with KpnI) pCGEN (Motteram et al. 2011) using the In-Fusion HD Cloning Kit (Takara Bio). The resulting vectors ...
-
bioRxiv - Molecular Biology 2024Quote: ... the annealed oligos were ligated into the digested lentiCRISPRv2 backbone using the DNA ligation kit (Mighty Mix) (Takara, Cat# 6023). Afterward ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were then reverse transcribed employing a One-Step SYBR PrimerScript reverse transcription (RT)-PCR kit (TaKaRa, Japan). Nested PCR conditions were as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... Final cDNA samples were used then used for quantitative real-time PCR assay by SYBR Green PCR Kit (RR820A, Takara). Quantitative primers were designed based on the gene sequences by Sangon Biotech ...
-
bioRxiv - Neuroscience 2024Quote: ... and then the tip of the recording electrode was broken into the nested PCR reagent system (Prime ScriptTm RT reagent Kit with QDNA Eraser, Cat: RR0471, Takara), and a cDNA synthesis kit was used to synthesize cDNA following the manufacturer’s protocol (PrimeScriptm II1st Strand cDNA Synthesis Kit) ...
-
bioRxiv - Microbiology 2024Quote: ... Total RNA was extracted using RNApure FFPE Kit (CWBIO, Jiangsu, China) and then treated with DNase I (TaKaRa, Kyoto, Japan) to remove DNA contaminants ...
-
bioRxiv - Immunology 2024Quote: RNA libraries of esophageal epithelial tissue biopsies and organoids were prepared using SMART-Seq HT Ultra Low Input RNA kit (Clontech) and NEBNext Ultra II RNA Library Prep Kit for Illumina ...
-
bioRxiv - Immunology 2024Quote: ... and quantified using bulk RNA-seq (Psomagen) after construction of Illumina sequencing libraries using the SMARTer Stranded Total RNA-Seq Kit v3 - Pico Input Mammalian (Takara). Noise from low-expression transcripts was filtered ...
-
bioRxiv - Immunology 2024Quote: ... we ran our linearized plasmid backbone and 83 bp PCR products on a 1% agarose gel and recovered each using the Gel and PCR Clean-up Kit (Takara) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... the pLVX-G9R+A1L-puromycin or pLVX-G9R+A1L-blasticidin plasmids were transfected into 293T cells using the Lenti-X Packaging Single Shots kit (631275, TaKaRa). Lentiviral supernatants were harvested 48 hours post-transfection and filtered through a 0.45 μm membrane (SLHV033RB ...
-
bioRxiv - Microbiology 2024Quote: ... All 3 fragments were then ligated into pUC18T-mini-Tn7T digested with EcoRI and XmaI using the infusion kit (Takara). The deletion of bspD was complemented by cloning of a 2160 bp long sequence encoding bspD and its upstream region including eipA and its 5’ non-coding region harboring the CtrA-controlled promoter (22 ...
-
bioRxiv - Cell Biology 2024Quote: ... the Sar1 genome template was first amplified from HeLa genomic DNA with following primers (CCGCTCTAGAACTAGTACCCAAATGAGCTCTGGC, CGGTATCGATAAGCTTGCATCAGTATTAAATACACATG) and cloned into pBSIISK(-) by In-Fusion HD cloning Kit (TAKARA). Next ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries from input and IP samples were prepared using the SMARTer Pico Input Mammalian v2 RNA-seq kit (Takara) and sequenced as SE50 runs on an Illumina HiSeq4000.
-
bioRxiv - Molecular Biology 2024Quote: ... except that raw read processing by Cutadapt had to be adapted to different library construction method (SMARTer smRNA-Seq Kit, TAKARA). In particular ...
-
bioRxiv - Plant Biology 2024Quote: Rapid amplification of cDNA ends (5’ RACE) was used to determine the transcripts of the RB gene using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the protocol ...
-
bioRxiv - Neuroscience 2023Quote: RNAs were extracted from cultured cells and tissues using RNA extraction kit and reverse transcribed into cDNAs (both from TAKARA) according manufacturers’ instructions ...