Labshake search
Citations for Takara Bio :
4151 - 4200 of 5356 citations for Pig Glucagon Like Peptide 2 GLP 2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was reverse transcribed to complementary DNA (cDNA) using a Prime Script™ RT Master Mix Kit (TaKaRa, China) and the following procedure ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR fragments containing M1 Spastin amino acids 197-328 was inserted into the C-terminus of FP-M11-92 linearized by BamHI enzyme using In-Fusion cloning kit (Takara). DsRed-M11-92-197-328 was constructed by replacing mApple in mApple-M11-92-197-328 with DsRed2 using NheI and EcoRI restriction sites ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription was performed on 2 μg of total RNA using the Primescript Reverse Transcription Kit with a mixture of oligo-dT primers and random hexamers (Takara) after TURBO™ DNase (ThermoFisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then each RNA sample (1 μg) was reverse transcribed using the Prime Script first-strand cDNA synthesis kit (catalog no. 6110A; TaKaRa). The internal control for qRT-PCR experiments was the 18S rRNA gene of BPH ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Forward (control) and reverse (target) RNA probes were synthesized from plasmids amplified via PCR (Advantage HD Polymerase Kit, Takara Bio) using T7 or SP6 RNA Polymerases (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNA was reverse transcribed into cDNA using SYBR® Premix DimerEraser™ (perfect Real Time) Kit (Takara, Shiga, Japan). Six pairs of specific primers were designed to amplify the genes selected from multiple comparisons (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... A 500 ng of the RNA was used for the 5’RACE reaction with SMARTer RACE 5’/3’ kit (Clontech), according to manufacture’s instruction ...
-
bioRxiv - Genetics 2020Quote: ... Microglial RNA was isolated using the TRIzol method and cDNA libraries were generated using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing Components (Takara) according to the manufacturer’s protocol.The libraries were sequenced as 150 bp paired-end reads with an average read depth of 42 million (range 16-98M ...
-
bioRxiv - Genetics 2020Quote: ... The guide for Cas9 was obtained by direct hybridization of the oligos and inserted in the same plasmid by Gibson assembly (In-Fusion HD cloning kit; Clontech) using the BtgZI sites.
-
bioRxiv - Microbiology 2020Quote: ... Cellular RNA was isolated at 6 hours post-infection (hpi) using a CellAmp Direct RNA Prep Kit (3732; Takara, Japan) and culture medium collected at 24 hpi or 27 hpi was diluted 10-fold in water ...
-
bioRxiv - Genetics 2021Quote: ... Samples of 500 ng of RNA were reverse transcribed using PrimeScript™ RT Reagent Kit (Perfect Real Time) (TAKARA, RR037A). qPCR was performed using TB Green Premix Ex Taq reagent (TAKARA ...
-
bioRxiv - Cell Biology 2019Quote: ... RNA with an OD value (A260/A280) of 1.8–2.0 was reversed transcribed to cDNA by using a PrimeScriptTM RT-PCR kit (Takara, Kusatsu, Japan). cDNA was amplified by Takara Taq™ (DR001AM ...
-
bioRxiv - Cell Biology 2021Quote: ... Viral RNA was quantified using a One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time) (Takara Bio) on a StepOnePlus real-time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... All constructs were generated with two-insert seamless cloning (In-Fusion HD Cloning Plus Kit from Takara Bio, Cat# 638910) using NheI/BamHI linearized plasmid backbones (Addgene plasmid #54759 ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-RACE cDNA was obtained from bulk-sorted B cells of each animal with SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The Ig PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Thermo Fisher ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Physiology 2021Quote: ... as well as the left and right homology arms were assembled and cloned into SmaI-digested pBluescriptII SK(-) in a single enzymatic reaction using the In-Fusion Cloning Kit (TAKARA). gRNA vectors were constructed in pDCC690 ...
-
bioRxiv - Plant Biology 2021Quote: Double-stranded RNA (dsRNA) of GFP and CHS were synthesized using the in vitro Transcription T7 Kit (Takara, Ohtsu, Japan). Briefly ...
-
bioRxiv - Genetics 2021Quote: ... Quantitative PCR was performed using KAPA SYBR Fast qPCR Kits (Nippon Genetics, Japan) on Dice Real Time System Single Thermal Cycler (Takara) or CFX96 Real- Time System (BioRad ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... a DNA fragment library of 220 bp insert size was prepared using the PrepX ILM 32i DNA Library Kit (Takara), and mate-pair libraries of 3 kb insert size were prepared using the Nextera Mate Pair Sample Preparation Kit (cat ...
-
bioRxiv - Neuroscience 2020Quote: ... the RNA sample was diluted into 140 ng/μL and purified with the Primescript TM RT regent kit (Takara, RR047). cDNA was generated using SYBR® Premix Ex Taq™ II kit (Takara ...
-
bioRxiv - Developmental Biology 2021Quote: ... cDNA synthesis from the total RNA was carried out using the PrimeScriptTM High Fidelity RT-PCR Kit (TaKaRa, Shiga, Japan) using an oligo dT primer ...
-
bioRxiv - Molecular Biology 2019Quote: ... The specific PCR products were gel purified by using the DNA Gel Extraction Kit (Axygen, USA) and cloned to the pMD-18 vector system (Takara), and then sequenced by the Shanghai Sangon Company.
-
bioRxiv - Biophysics 2020Quote: pDNA_HaloTag/SNAP-tag/GFP vectors encoding each target protein (see Note 1),which were inserted by In-Fusion HD Cloning Kit (Clontech) or Seamless Ligation Cloning Extract (SLiCE ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA libraries were generated using Takara’s SMART-Seq v4 Low Input RNA Kit for Sequencing (Takara, Mountain View, California, USA) for cDNA synthesis and the Illumina NexteraXT DNA Library Preparation (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... Libraries were simultaneously prepared using Takara’s SMARTer Stranded Total-RNA Pico v2 library preparation kit following manufacturer’s protocol (Takara cat#634412). Prepared libraries were sequenced on Illumina Nextseq500 at 2×75cycles.
-
bioRxiv - Pathology 2021Quote: ... First-strand complementary DNA was synthesized from total RNA using a PrimeScriptTM RT reagent kit with gDNA Eraser (Takara, China). Then ...
-
bioRxiv - Biochemistry 2021Quote: ... falciparum cDNA followed by Ligation Independent Cloning into HindIII/KpnI-cleaved plasmid pOPIN F (82) using the In-Fusion HD EcoDry Cloning Kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: The reverse-stranded total RNA-seq libraries (Fig. 4 and Fig. S2A) were prepared using the SMARTer-Seq Stranded kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Mutations with multiple amino acids were introduced by ligating inverse PCR-amplified backbone with mutations bearing DNA oligonucleotides via the In-Fusion Cloning Kit (ClonTech). All mutants were confirmed by Sanger sequencing.
-
bioRxiv - Cell Biology 2021Quote: ... 1 × 106 HEK293T cells were transfected with 4 μg donor and 2.5 μg pX330 Cas9 plasmid (CalPhos™ Mammalian Transfection kit, Clontech). After 72 h ...
-
bioRxiv - Cell Biology 2021Quote: ... One microgramme of total RNA was reverse-transcribed using a One Step PrimeScript™ RT-PCR Kit (Takara, Liaoning, China) with a thermocycler ...
-
bioRxiv - Cell Biology 2021Quote: ... The srpHemo promoter fragment was inserted at the Stu1 restriction site of the PCasper4 plasmid52 using the infusion kit from Clontech and the following infusion primer pair ...
-
bioRxiv - Genomics 2020Quote: ... We synthesized and amplified complementary DNA (cDNA) from each tissue using the SmartSeq v4 Ultra Low-input RNA kit (Clontech) from 1 ng of input RNA with 17 cycles of PCR ...
-
bioRxiv - Genetics 2020Quote: ... Three overlapping MTM1 cDNAs were amplified using three pairs of cDNA primers from Tosch et al(Tosch et al. 2010) using the PrimeSTAR GxL kit (Takara). Primers are F1/R1 (ATGGCTTCTGCATCAACTTC / TGGAATTCGATTTCGGGAC ...
-
bioRxiv - Cancer Biology 2021Quote: ... by subcloning it into the multiple cloning site of the pKT2/CAGXSP vector19 through recombination cloning (In-Fusion HD Cloning Kit, Clontech). For the EV reporter ...
-
bioRxiv - Microbiology 2021Quote: ... the pLVX-ORF3-E plasmid was transfected into HEK-293T cells using the Lenti-X Packaging Single Shots kit (Takara). Lentiviral supernatants were harvested at 72 h post-transfection and filtered through a 0.22 μM membrane (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... retroviral packaging construct pTG5349 and a reporter pCCLSIN.cPPT.hPGK.GFP.WPRE into HEK 293T cells by calcium-phosphate method (Calphos Mammalian Transfection kit, Clontech as per manufacturer’s instructions). Cells were seeded on 60×15mm dish a day before transfection to achieve 70 – 80% confluency ...
-
bioRxiv - Molecular Biology 2021Quote: Genes of interest were amplified from genomic DNA of W303-1A and cloned into the respective vector using the In-Fusion HD cloning kit (Clontech). Mutations and deletions were introduced by oligonucleotide-directed site-specific mutagenesis.
-
bioRxiv - Microbiology 2020Quote: ... All elements of the PbDCIII plasmid were amplified by PCR using standard PCR conditions (using the CloneAmp HiFi PCR premix) and sequentially ligated into the SphI-SalI restriction sites of a pUC18 vector (In-Fusion HD Cloning Kit, Clontech). The resulting plasmid sequence was verified by Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2020Quote: ... All elements of the DiCre plasmid were amplified by PCR using standard PCR conditions (using the CloneAmp HiFi PCR premix) and sequentially ligated (In-Fusion HD Cloning Kit, Clontech) into an acceptor plasmid containing a TgDHFR/TS cassette flanked by two LoxP sites ...
-
bioRxiv - Microbiology 2020Quote: ... The double-stranded oligonucleotides were end-labeled with [α-32P]-dCTP with the Random Primer Labeling Kit (Takara, Dalian, China). The binding reaction (28 μl ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were originally obtained from ATCC (except MAGIC5 cells) and routinely tested negative for mycoplasma contamination (PCR Mycoplasma Detection kit, Takara).
-
bioRxiv - Microbiology 2020Quote: ... The infectious titer of lentivirus was determined by a Lenti-X™ qRT-PCR Titration Kit (Clontech, Mountain View, CA).
-
bioRxiv - Microbiology 2020Quote: ... Removal of genomic DNA and synthesis of cDNA were performed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Japan). The concentration of purified RNA was quantified on a Nanodrop ND-1000 spectophotometer (NanoDrop Technologies ...
-
bioRxiv - Immunology 2021Quote: ... Cells were sorted directly into lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara) and frozen until all samples were ready for simultaneous processing ...
-
bioRxiv - Immunology 2021Quote: ... Cell lysis was quantified by measuring the amount of intracellular LDH release into the cell culture supernatant (TaKaRa LDH cytotoxicity detection kit; Clontech). Percentage PI uptake and LDH release were calculated relative to 100 % cell lysis in untreated control sample.
-
bioRxiv - Molecular Biology 2021Quote: ... Mutations with multiple amino acids were introduced by ligating inverse PCR-amplified backbone with mutations bearing DNA oligonucleotides via the In-Fusion Cloning Kit (ClonTech). All mutants were confirmed by Sanger sequencing.
-
bioRxiv - Immunology 2020Quote: ... The infectious units per mL was determined using the AdenoX Rapid Titer kit according to the manufacturer’s instructions (Clontech Laboratories).
-
bioRxiv - Immunology 2021Quote: ... This amplicon was cloned into a pLEX lentiviral backbone cut with BamHI and XhoI using the InFusion HD kit (Takara). pLEX-ACE2 was co-transfected with psPAX2 and pMD2.G into 293FT cells for lentiviral packaging ...