Labshake search
Citations for Takara Bio :
3601 - 3650 of 5321 citations for Human Lysine K Specific Demethylase 1A KDM1A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... CquiOR27 and CquiOR28 were subcloned separately from pGEM-T-CquiOR27 and pGEM-T-CquiOR28 into pGEMHE using In-Fusion HD Cloning Kit according to the manufacturer’s instructions (Clontech). PCR In-Fusion primers were designed according to the user manual ...
-
bioRxiv - Bioengineering 2022Quote: HEK293T cells were transfected with given plasmids and then harvested for RNA extraction by NucleoSpin RNA Plus Kit (Takara) 48 hour after transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... The BAC containing Idh was extracted from 200 ml bacterial cultures using the NucleoBond Xtra Midi kit (Takara Bio). The fluorescence in situ hybridization (FISH ...
-
bioRxiv - Molecular Biology 2022Quote: ... qRT-PCR was carried out by using TB Green Premix Ex Taq II (Tli RNaseH Plus) kit (Takara, China) on ABI7500 Real-time system (Applied Biosystems ...
-
bioRxiv - Neuroscience 2022Quote: ... a sequence region of 5,000 bp between SnaBI and AgeI restriction sites was amplified using the HiFi amplification kit (Clontech, Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2022Quote: ... Splice sites (SS) mutations were introduced in the corresponding parental plasmid using In-Fusion HD Cloning kit (Takara Bio) to generate pcDNA3.1-RLuc_FOXP3 Intron 7 5’-SS G- U ...
-
bioRxiv - Molecular Biology 2022Quote: The quantified RNA was converted into copy DNA (cDNA) using Primescript™ 1st strand cDNA synthesis kit (TaKaRa, Japan). 1st Reaction Mixture was prepared by adding 8.0 µl of RNA (1.0μg/concentration adjusted to 125.0ng/µl) ...
-
bioRxiv - Bioengineering 2022Quote: ... A lentiviral transfer plasmid co-encoding zsGreen with Oatp1b1 was cloned using the In-Fusion HD Cloning kit (Takara Bio USA Inc ...
-
bioRxiv - Developmental Biology 2022Quote: ... The RNA-seq library was prepared with SMARTer® Stranded Total RNA-Seq Kit v2 – Pico Input Mammalian (Takara), and sequencing was performed in the Next Generation Sequencing platform using NextSeq500 (Illumina) ...
-
bioRxiv - Immunology 2022Quote: The sequence of anti-IFNγ was cloned from XMG1.2 hybridoma (ATCC) using SMARTer RACE 5’/3’ kit (Takara Bio). The 6xHis tagged anti-Dsg ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was prepared from 1 μg of total RNA using PrimeScript 1st strand cDNA Synthesis Kit (TaKaRa, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... RNA was reverse transcribed to cDNA using the PrimeScript™ RT reagent Kit with gDNA eraser (Takara, Kusatsu, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Forty ng cDNA was used as templates for RT-PCR using SYBR® Premix Ex Taq kit (TaKaRa, #RR820A) using LightCycler 96 (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNAseq libraries were made using the SMARTer ultra-low RNA kit V3 (Takara Bio USA, Mountain View, CA, USA). and analysed individually (i.e. ...
-
bioRxiv - Cancer Biology 2022Quote: Four hundred nanogram total RNA was employed for cDNA synthesis using ProtoScriptII First Strand cDNA Synthesis kit (TaKaRa,#RR036A) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: To eliminate nucleotides that are part of the template-switching oligo as per the manufacturer’s instructions (SMARTer Stranded Total RNA-Seq Kit - Pico Input Mammalian; v1 [mPFC] or v2 [HIP]; Takara), the first three nucleotides of the first sequencing read (Read 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA samples with RIN values >8 were used for library preparation according to manufacturer’s instructions (SmartSeqv4 RNASeq kit, Clontech) or manual library preparation for Ampliseq analysis (Ion AmpliSeq Lib Kit Plus) ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized with the SMART-Seq® v4 Ultra® Low Input RNA Kit for Sequencing (Takara/Clontech) and assessed with the Bioanalyzer high sensitivity DNA kit ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized with the SMART-Seq® v4 Ultra® Low Input RNA Kit for Sequencing (Takara/Clontech) and assessed with the Bioanalyzer high sensitivity DNA kit ...
-
bioRxiv - Microbiology 2021Quote: ... The four amplicons and a SacI-digested pUC19 vector were fused using an In-Fusion HD Cloning Kit (Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... The construction of a library was performed using a SMARTer Stranded RNA-Seq Kit (Clontech Lab Inc., CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was then synthesized from 1μg of total RNA from each sample using a PrimeScript 1st Strand cDNA synthesis kit (TaKaRa). Real-time RT-PCR was performed using the following primer sequences ...
-
bioRxiv - Developmental Biology 2021Quote: cDNA was synthesized using SMARTer Ultra Low Input RNA for Illumina Sequencing-HV kit (Clontech Laboratories; Cat. No. 634820) according to the manufacturer’s instructions and as previously published (Blakeley et al. ...
-
bioRxiv - Molecular Biology 2021Quote: The s2m sequence or control scrambled sequence of s2m (s2m_scr) was inserted into the 3’ UTR of GFP in H6P plasmid using In-Fusion Cloning kit (TaKaRa) and verified by sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... AAVS1 barcoded AAV6 donors were produced as described above but purified using a commercial purification kit (Takara Bio #6666).
-
bioRxiv - Plant Biology 2021Quote: ... Each RNA sample was reverse-transcribed to cDNA after DNase I treatment using a PrimeScript RT reagent kit (Takara). PCR was performed as described in Kumar et al ...
-
bioRxiv - Cell Biology 2020Quote: RNA samples were subjected to library preparation for the Illumina platform using the SMART-Seq Stranded Kit (Takara #634443) as manufacturer instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... and the resulting double-stranded fragments were subcloned at the BsaI site of the pMpGE_En03 vector (Sugano et al., 2018) using the DNA ligation kit Ver.2.1 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from the samples using a NucleoSpin® RNA Plant kit (Takara Bio Inc., Kusatsu, Japan) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... An equal amount of RNA for each sample was converted to cDNA using PrimescriptTM RT Reagent Kit (Takara Bio), or Superscript IV (Thermofisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... by seamless cloning according to the instruction of In-fusion® HD Cloning Kit (Clontech, Palo Alto, CA, USA). NLS was inserted into pcDNA3.1 using High-Efficient Ligation Reagent Ligation High (TOYOBO) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products of EgGLUT1-ss gene were recovered from Agarose Gel with Agarose Gel DNA Extraction Kit (Takara, Japan), and the amplified fragments were cloned into pMD19-T vector with Mighty ta-cloning Reagent Set for Prime STAR (Takara ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA libraries were prepared by the core using Takara’s SMART-seq v4 Ultra Low Input RNA Kit (Takara 634888) and sequenced on Illumina’s NovaSeq 6000 platform ...
-
bioRxiv - Microbiology 2021Quote: ... indexed cDNA libraries were prepared using the SMARTer Stranded RNA-Seq Kit (Takara Bio USA, Mountain View, CA, USA). Library preparation was performed according to the instructions ...
-
bioRxiv - Genetics 2022Quote: ... 1 µg of total RNA was used for reverse transcription using PrimeScript RT Reagent Kit (Cat#RR037A, TaKaRa, Japan). Quantitative polymerase chain reaction (qPCR ...
-
bioRxiv - Biochemistry 2022Quote: One μg of RNA per kidney half was reverse-transcribed using PrimeScript RT Reagent kit (RR037 TAKARA, Shiga, Japan). Two μl of cDNA was used for quantitative real-time PCR to assess gene mRNA expression ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and then was transcribed to cDNA using the Clontech SMARTer PCR cDNA Synthesis Kit (Clontech, Mountain View, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... One microgram of total RNA was used for preparing cDNA using PrimeScript™ 1st strand cDNA Synthesis Kit (Clontech) following the manufacturer’s protocol.
-
bioRxiv - Genetics 2019Quote: ... First-strand cDNA was reverse transcribed from 1μg of total RNA using the PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa). Rice ubiquitin (UBQ ...
-
bioRxiv - Cell Biology 2019Quote: ... Each sub-cloning was done by using the In-Fusion PCR cloning kit (Clontech Laboratories, Mountain View, CA, USA). Plasmids were integrated at the lys1 gene locus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Full length cDNA synthesis was done from polyA RNA using Clontech SMARTer PCR cDNA synthesis kit (Clontech Laboratories; (23)) ...
-
bioRxiv - Immunology 2019Quote: ... The libraries were prepared using the SMARTer® Stranded Total RNA-Seq - Pico Input Mammalian - kit (Takara Bio, USA) following the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2019Quote: ... followed by self-circularization using the In-Fusion HD Cloning Kit (Cat# 639648, Clontech Laboratories, Mountain View, CA, USA).
-
bioRxiv - Immunology 2019Quote: ... cDNA and library preparation were performed with a SMART-Seq v4 Ultra Low Input RNA Sequencing Kit (Takara Bio) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... The amplified genes were cloned in the pOPIN_S vector [40] using the In-Fusion HD Cloning Kit (Takara Clontech). Point mutations were generated using the QuikChange Lightning kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2020Quote: ... The amplified genes were cloned in the pOPIN_S vector [40] using the In-Fusion HD Cloning Kit (Takara Clontech). Point mutations were generated using the QuikChange Lightning kit (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2019Quote: ... Neurons were transfected with 1.0 μg of scrambled or Rai1-shRNA-expressing plasmids with the CalPhos Transfection kit (ClonTech) or Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... GGTATCGATAAGCTTACCAGGTAATGCAAGTCCTCGCCG and pBS2_Pericentrin C-ter_InsR: CGCTCTAGAACTAGTAGAATGCTCCGGGTTCCACTGA) from the genomic DNA of HeLa cells and cloned into pBluescript using the Infusion Cloning kit (Takara). A BamHI sequence with a silent mutation to prevent re-cutting was generated in the middle of the homology arm domain by mutagenesis PCR (Pericentrin C-ter silent BamHI_F ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2020Quote: ... and 250 ng RNA of each sample was reverse transcribed to cDNA using the Primescript RT kit (Takara Bio) according to the manufacturer’s instructions ...