Labshake search
Citations for Takara Bio :
3851 - 3900 of 5321 citations for Human Lysine K Specific Demethylase 1A KDM1A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... to a final concentration of 108-109 IFU/ml using the Lenti-x qRT-PCR Titration Kit (Takara, cat.631235). Lentivirus with MOI of 10 was used for transduction of MOVAS cells ...
-
bioRxiv - Genetics 2021Quote: ... The volume was brought to 11.5 μl and libraries were processed using the SMART-Seq HT library preparation kit (634456, Takara Bio) as described (Blackburn et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... Real-time quantitative PCR was performed in triplicate using the SYBR Premix Ex Taq (Tli RNase H Plus) kit (Takara). The expression of TBP was used for the normalization of mRNA expression ...
-
bioRxiv - Genetics 2021Quote: ... and then RT-qPCR was performed using a One Step SYBR PrimeScript PLUS RT-PCR kit (Takara Bio, Shiga, Japan) and Applied Biosystems ABI Prism 7000 Sequence Detection System ...
-
bioRxiv - Molecular Biology 2020Quote: ... a fluorescent quantitative PCR was carried out in accordance with the manufacturer’s instructions of a SYBR® Premix Ex TaqTM II (Tli RNaseH Plus) kit (Takara). The primers were synthesized by RiboBio Company and were shown in Table 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The purified PCR products were cloned into the expression vector pFO4 predigested with EcoRI and BamHI using the In-Fusion HD Cloning kit (TaKaRa). This plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA libraries were prepared using 1-5 ng of starting material using the SMARTer ThruPLEX DNA-Seq kit (Takara; R400674) according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 4 kb of the 3’ flanking region of MpBLD10 was inserted into the SmaI site of the pENTR/D-TOPO vector containing proMpBLD10 by using an In-Fusion HD cloning kit (Clontech). A silent mutation was introduced into the PAM site by inverse PCR ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The CDS of monomeric Citrine was introduced into the SmaI site of the pENTR/D-TOPO vector containing the MpBLD10 genomic fragment by using an In-Fusion HD cloning kit (Clontech). The chimeric sequence was introduced into pMpGWB301 (Ishizaki et al ...
-
bioRxiv - Developmental Biology 2020Quote: Total RNA purified from snap-frozen larvae using the Trizol method and used as template to synthesize random-primed cDNA using the Primescript cDNA synthesis kit (TaKaRa). Relative gene expression levels were measured by qRT-PCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... RT-qPCR analyses were carried out with KAPA SYBR FAST qPCR kits using a Thermal Cycler Dice Real Time System (TaKaRa) according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA libraries were generated using Takara’s SMART-Seq v4 Low Input RNA Kit for Sequencing (Takara, Mountain View, California, USA) for cDNA synthesis and the Illumina NexteraXT DNA Library Preparation (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... and we immediately used these cells for reverse-transcription and cDNA amplification with a Smart-Seq HT kit (Cat# 634437, Takara). The cDNAs (1 ng each ...
-
bioRxiv - Plant Biology 2022Quote: ... and 3’ UTR region was cloned into the BamHI/XhoI site of pBluescript KS– using an In-Fusion HD cloning kit (Takara), yielding pOsSOG1_7A ...
-
bioRxiv - Molecular Biology 2022Quote: About 1μg of RNAs were reverse transcribed into cDNAs using a PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Japan) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Amplified fragments were cloned into the TRV vector (pTRV2) (Lu et al., 2003) using the In-Fusion HD cloning kit (Clontech). Agrobacterium strains containing desired pTRV2 constructs were co-infiltrated with strains carrying pTRV1 at OD600=0.5 into N ...
-
bioRxiv - Microbiology 2022Quote: ... non-structural genes were PCR amplified in three fragments from the pRepDVRluc plasmid [37] and all fragments were inserted into the PUb-MCS-2A-Puro plasmid [64] using In-Fusion cloning kit (Takara) to generate the PUb-NS(Ø ...
-
bioRxiv - Developmental Biology 2022Quote: ... Three nanograms of total RNA were used for amplification using the SMART-Seq V4 Ultra Low Input RNA kit (Clontech) according to the manufacturer’s recommendations (10 PCR cycles were performed) ...
-
bioRxiv - Neuroscience 2021Quote: ... Groups of 6-10 cells were dispensed from the micropipette into 1 µl ice-cold 10x reaction buffer (SMART-Seq v4 kit, Takara) and flash-frozen before library preparation ...
-
bioRxiv - Cell Biology 2022Quote: ... LC NLS deletion (Δ417-422) was generated by KOD One PCR amplification and the In-Fusion HD Cloning Kit (Clontech). The NLS of SUN2 (KDSPLRTLKRKSSNMKRL ...
-
bioRxiv - Developmental Biology 2022Quote: ... 250–2000 pg of total RNA was loaded as a template for cDNA synthesis using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech) with template switching technology ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and each RNA concentration was measured by quantitative PCR after reverse transcription using PrimeScript One Step RT-PCR Kit (TaKaRa) with each specific primer (Table S2).
-
bioRxiv - Genomics 2020Quote: ... 0.8μg of Total RNA was utilized as template for RT with random hexamer primers using PrimeScript RT reagent Kit (Takara). qRT-PCR was performed with respective gene-specific primers (PD GFD ...
-
bioRxiv - Genomics 2019Quote: ... RNA libraries from thymic cells isolated from lentigenic mice or actinomycin D-treated mTEChi were constructed with the Smarter Ultra Low Input RNA kit (Clontech) combined to the Nextera library preparation kit (Illumina) ...
-
bioRxiv - Immunology 2021Quote: NGS transcriptome libraries were generated from 73 healthy baseline samples and 95 convalescence samples using the SMART-Seq v4 Ultra low Input RNA kit (Takara), an optimized version of the SMART-Seq2 method ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA was synthesized from the RNA using the PrimeScriptTM RT Reagent Kit with gDNA Eraser (Takara Bio Inc, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... both input and IP samples were used for library construction with the SMARTer Stranded Total RNA-seq Kit v2 (634413, Takara), and sequenced by Illumina HiSeq X Ten to produce 150 bp paired-end reads.
-
bioRxiv - Molecular Biology 2019Quote: The SINV-GFP-mut plasmid was generated by site directed mutagenesis using forward (5’ CGCATTTATCAGGACATCAGATGCACCACTGGTCTCA 3’) and reverse (5’ ATGTCCTGATAAATGCGGCGTTCGGGATGTCAATAGA 3’) primers and the In-Fusion HD Cloning Kit (Takara) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2019Quote: ... followed by reverse transcription of the enriched mRNA into cDNA using Clontech SMARTer PCR cDNA Synthesis Kit (Takara, Shiga, Japan). PCR cycle optimization was used to determine the optimal amplification cycle number for the downstream large-scale PCR reactions ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was collected from iPSC-derived day 12 cExN and cIN NPCs using the NucleoSpin RNA II kit (Takara) per the manufacturer’s instructions ...
-
bioRxiv - Pathology 2020Quote: ... The PCR assay was conducted as described previously9 and the complete genome termini was determined using the Takara SMARTer RACE 5’/3’ kit (TaKaRa) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA-seq library was generated using the SMART-seq v.4 Ultra Low Input RNA Kit (Takara Bio, Kusatsu, Japan) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Genetics 2019Quote: ... Isolated RNA was reverse transcribed into cDNA was by Prime Script TM RT reagent Kit with gDNA Eraser (Stratagene, Takara). Real-time PCR was performed on ABI-7500 real-time PCR machine (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2019Quote: ... All the amplicons were cloned into a lentiviral plasmid pCSII–CMV–MCS (RIKEN, RDB04377) by using the In-Fusion HD Cloning Kit (TaKaRa), to produce the pCSII– CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid.
-
bioRxiv - Developmental Biology 2019Quote: ... The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech). All PCR-amplified products for both plasmids were sequenced to exclude the possibility of second site mutagenesis ...
-
bioRxiv - Developmental Biology 2019Quote: ... plasmid after digestion of the inserts by EcoRI and KpnI and cloning into the EcoRI and EcoRV sites in frame with the C-terminal Flag tag in pSNAPf plasmid using In-Fusion Kit (Clontech). The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech) ...
-
bioRxiv - Immunology 2019Quote: ... all cDNA libraries were constructed and amplified using the SMARTer Stranded Total RNA-Seq Kit (v1 or v2) - Pico Input Mammalian (Clontech) per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... flowthrough and input samples were prepared for sequencing using the SMARTer Stranded RNA-Seq Kit (Takara Bio, Mountain View, CA).
-
bioRxiv - Microbiology 2019Quote: ... and N-glycolylneuraminic acid (NeuGc) released were labeled with 1,2-diamino-4,5-methylenedioxybenzene (DMB) using a commercial kit (Takara, Shiga, Japan). The DMB-labeled sialic acids were analyzed by HPLC equipped with a TSK-ODS80Ts column (Tosoh ...
-
bioRxiv - Plant Biology 2019Quote: The amplified fragment was cloned into the XbaI site of pENTR1A (no ccdB) using an In-Fusion HD Cloning Kit (TaKaRa). In the same way ...
-
bioRxiv - Microbiology 2019Quote: ... the NS3 fragments with FLAG-tag and NS3 cDNA vector were ligated together at an approximate molar ratio of 1:3 using TaKaRa DNA Ligation Kit LONG (TAKARA) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: ... The IL-1β and components of RISC mRNA expression levels of the NA cells were quantified with the SYBR Green qPCR kit (Takara) by following the manufacturer’s instruction using gene-specific primers (S2 Table) ...
-
bioRxiv - Immunology 2019Quote: ... JUN-P2A was then subcloned into the XhoI site of MSGV CAR vectors using the In-Fusion HD cloning kit (Takara) upstream of the CAR leader sequence to create JUN-P2A-CAR retroviral vectors ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5’ and 3’ RACE was carried out according to the manufacturer’s protocol of SMART RACE cDNA Amplification kit (Clontech, Takara, Japan). The sequences of primers for RACE are as follows ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and a modified vector with an N-terminal AviTag for biotinylation and C-terminal His6-tag (p28BIOH-LIC) using a ligation-independent InFusion cloning kit (ClonTech) and verified by DNA sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... These PCR products were cloned into pCA24N with a C-terminal GFP tag using the In-Fusion HD enzyme kit (Takara). Clones were selected on TSA plates with 50µg/ml chloramphenicol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The PCR products were cloned into pBAD28 vector (ATCC® 87400™) by using In-Fusion HD Cloning kit (Takara) by using primers 7 and 8 to amplify pBAD28 vector (Table S2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was synthesized from 1.0 μg of each RNA sample using PrimeScript RT Kit with gDNA Eraser (TaKaRa, Dalian, China).
-
bioRxiv - Immunology 2019Quote: ... was added to each sample and first strand full length cDNA was generated with a modified protocol of the SMARTseq v4 Ultra Low Input RNA Kit (Takara Clontech) using poly dT primers and a template switching oligo ...
-
bioRxiv - Molecular Biology 2019Quote: ... The RNA was subjected to reverse transcription (RT) for 15 min at 37°C with the use of a PrimeScript RT Reagent Kit with gDNA Eraser (Takara), after which the reaction was terminated by incubation at 85°C for 5 s ...