Labshake search
Citations for Takara Bio :
301 - 350 of 535 citations for Anion Exchange Membranes Thickness 10 13 µm since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 10 ml of virus containing media were concentrated with Lenti-X concentrator (Takara Bio, 631231) to a titer sufficient to decrease pStat1 levels by 25% (Mean pStat1+ CD11b+ cells ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 10 ng of cDNA was analyzed using SYBR Premix Ex Taq II (TaKaRa Biotechnology) on a CFX Connect TM Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Genetics 2021Quote: ... Viral supernatant was further concentrated 10-fold using the lenti-X™ Concentrator (Takara Bio) following the manufacturer’s instructions and subsequently stored at −80°C.
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1%BSA and 10% FBS.Cells were incubated with anti-c-Myc antibody (Clontech Laboratories, USA) at a 1:10 dilution for 16 hr at 4°C ...
-
bioRxiv - Genomics 2021Quote: Hap1 cells were cultured in Iscove’s Modified Dulbecco’s Medium (IMDM) supplemented with 10% FCS (Clontech), 1% Penicillin/Streptomycin (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... 6.8 μl of ddH2O and 10 μl of Power SYBR Green qPCR Master Mix (TaKaRa). Three technical replicates ...
-
bioRxiv - Neuroscience 2022Quote: ... and either 4 wells of 10 pg of Human Universal Reference Total RNA (Takara 636538) or 2 wells of 10 pg of Human Universal Reference and 2 wells of 10 pg Control RNA provided in the Clontech kit ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... 10 ng cDNA in a 25 μl reaction mixture containing 1 X ExTaq buffer (TaKaRa), 200 μM each of NTP and 800 nM of primers along with 0.625 units ExTaq HS (TaKaRa ...
-
bioRxiv - Cell Biology 2023Quote: ... hygromycin B (300 µg/ml) and 10% tetracycline free fetal bovine serum (Takara Bio, USA) in a humidified incubator at 37°C in 5% CO2 in 6-well plates ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 μl of TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (TaKaRa Bio), 0.4 μl of forward and reverse primers (10 μM) ...
-
bioRxiv - Microbiology 2024Quote: ... containing TAKARA Ex Taq® buffer with MgCl2 (10 X; Takara Bio Inc., Tokyo, Japan), primers at 200 nM ...
-
bioRxiv - Zoology 2024Quote: ... 10 μ L of TB Green Premix Ex Taq 2 (TliRNaseH Plus) (TaKaRa, Dalian, China), 1 μ L of each primer (10 μ mol/L) ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA (10 ng) was extracted for library preparation using a SMART-Seq Stranded Kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction mixture contained 10 μL of SYBR® Primer EX Taq II (Takara, Japan, RR420A), 0.4 μL ROX Reference Dye (50× ...
-
bioRxiv - Genetics 2022Quote: ... The 20 µL PCR reaction volume included 10 µL Premix Ex Taq enzyme (Takara Biomedical Technology), 0.2 µL BSA ...
-
bioRxiv - Neuroscience 2022Quote: ... media was collected and concentrated 1:10 in 1xPBS using Lenti-X concentrator (Takara Bio, #631231), aliquoted ...
-
bioRxiv - Molecular Biology 2020Quote: ... The DIE cells were cultured in IMDM media supplemented with 10% Tet system approved FBS (Clontech), 5μg/ml Puromycin and 6μg/ml Blasticidin ...
-
bioRxiv - Genomics 2021Quote: ... Two DNA polymerases were evaluated (barcode 10 used high-fidelity LA (for “long amplicon”) Taq (Takara); barcode 11 Taq (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... mCherry-H2B HeLa cell lines were cultured in DMEM (PAM Biotech) supplemented with 10% FBS (Clontech), 2 mM L-glutamine (PAN Biotech) ...
-
bioRxiv - Genetics 2022Quote: ... in a 10 µL reaction volume with the PrimeScript RT Reagent Kit with gDNA Eraser (Takara) following the recommended protocol ...
-
bioRxiv - Physiology 2024Quote: ... 10 μM Reverse primer and TB Green Premix Ex Taq II (Tli RNaseH Plus) (Takara, #RR820W). Real-Time PCR was set up in a 384-well plate and run in a CFX384 Real-Time PCR System (BioRad ...
-
bioRxiv - Neuroscience 2023Quote: ... U2OSQ94 cells were cultured in DMEM +Glutamax supplemented with 10% Tet system approved FBS (Takara, 631368) and 1% Penicillin/Streptomycin ...
-
bioRxiv - Immunology 2023Quote: ... (Cat.No. 632180) were cultured in DMEM supplemented with 10% Tet System Approved FBS (Takara, Cat.No. 631106). All cell lines were cultivated at 37°C in a humidified atmosphere with 5% CO2.
-
bioRxiv - Genetics 2024Quote: ... Aliquots of these samples were diluted 1:10 and 1:100 on two plates (Takara Bio): (1 ...
-
bioRxiv - Genetics 2024Quote: ... Aliquots of these samples were diluted 1:10 and 1:100 on three plates (Takara Bio): (1 ...
-
bioRxiv - Plant Biology 2024Quote: ... The 20-ml reaction mixture contained 10 ml of 2× TB Green Premix Ex Taq (Takara), 2 ml of diluted complementary DNA (1:5) ...
-
The pan-cancer lncRNA PLANE regulates an alternative splicing program to promote cancer pathogenesisbioRxiv - Cancer Biology 2020Quote: ... containing 10 μl of TB Green Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa, #RP820A; Dalian, China) and 0.4 μM of each primer ...
-
bioRxiv - Immunology 2022Quote: ... Rearranged VDJ IGM and IGG amplicons were generated using a universal forward primer (Takara Bio;10 μM), and either an IgM-CH3 (5’-CAGATCCCTGTGAGTCACAGTACAC-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... LASVpp-BlaM virus was concentrated 10 times with Lenti-X concentrator (Clontech Laboratories, Mountain View, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... The 20-µL reaction volume comprised 10 µL 2× SYBR Green PCR Master Mix (Takara, Dalian, China), 0.2 µM each primer ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% Tet System Approved FBS (Clontech), 100 U/ml penicillin and 100 µg/ml streptomycin (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were incubated 30 min at RT and loaded onto a 10 μL aliquot of Talon (Takara) resin ...
-
bioRxiv - Immunology 2021Quote: ... Viral supernatants were collected after 48h and loaded onto retronectin-coated (10 ug mL−1, Takara Bio) non-TC 24-well plates ...
-
bioRxiv - Cell Biology 2022Quote: ... 2019) and 10 fmol JF646-LANA (see below) in 0.5 nL phosphate-buffered saline (PBS, Takara, T900) containing 0.05% phenol red (SIGMA ...
-
bioRxiv - Immunology 2023Quote: ... RNA extracted and amplified (10 ng RNA/sample) using SMART-Seq® HT kit (Takara Bio, #634455) according to the manufacture’s instruction ...
-
bioRxiv - Immunology 2023Quote: ... RNA extracted and amplified (10 ng RNA/sample) using SMART-Seq® HT kit (Takara Bio, #634455) according to the manufacture’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA was heat denatured and digested with 10-20 U of MazF enzyme (TakaRa, ref. 2415A) for 15 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 500 ng of total RNA was then reverse transcribed in 10 µL reactions using PrimeScript RT (TAKARA) and random hexamer primers ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The resin was washed twice by incubating it with 1 mL equilibration buffer for 10 minutes (Takara), centrifuging the resin (700xg for 5 minutes ...
-
bioRxiv - Biophysics 2024Quote: Cells were grown in DMEM culture media (Thermo-Fisher) supplemented with 10% tetracycline-free FBS (Clontech, 631106), 1% sodium pyruvate (NaPy ...
-
bioRxiv - Bioengineering 2024Quote: ... a new 24-well non-treated tissue culture plate was coated with 10 µg retronectin (Takara, T100A) in 1 ml PBS per well ...
-
bioRxiv - Genetics 2024Quote: ... Viral supernatant was harvested after 48 hours and concentrated 1:10 using the Lenti-X concentrator (Takara). Concentrated supernatant was resuspended in PBS and stored at -80°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 AtCBLs prey vectors were co-transformed into the yeast strain AH109 following manufacturer’s instructions (Clontech, CA, USA). The empty vectors pTOOL27 and pTOOL28 were also co-transformed into yeast with each prey or bait plasmid respectively to confirm that bait does not autonomously activate the reporter genes in the absence of the prey protein.
-
bioRxiv - Genetics 2021Quote: ... followed by a final extension at 72 °C for 10 min by using Takara Taq polymerase (Clontech, #TAKR001). To remove the DsRed cassette ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 ng of Renilla luciferase (pTK r.luc) by using 4 µl of TransIT 293 (Takara, Shiga, Japan) and 100 µl of OPTI- MEM (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... and sgRNA were cultured at 37°C and 5% CO2 in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, HyClone) supplemented with 10% (v/v) FBS (ClonTech), 250 µg/ml hygromycin ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Biophysics 2021Quote: ... A total of 20 μl reaction system contains 10 μl 2X Premix Ex Taq II (TaKaRa, Dalian, China), 1 μl of 3D gene specific primer (forward ...