Labshake search
Citations for Takara Bio :
3401 - 3450 of 5201 citations for Human Luteinizing Hormone Beta Polypeptide LHb CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The entire fragment was then infused into a pCAGGS expression vector using an Infusion HD cloning kit (Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... ssDNA was purified using the Nucleospin Gel and PCR Clean-up kit (Machery-Nagel, distributed by Takara Bio USA) with buffer NTC used as recommended by the manufacturer ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... while those with <15ng were prepared using the SMARTer® ThruPLEX® DNA-Seq Kit (Takara Bio Inc, Japan) in the sensi-lab at NHM Oslo (Table S1) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Complementary DNA libraries were prepared using the SMART-Seq v4 Ultra Low Input RNA kit for Sequencing (TAKARA Bio) and Nextera XT DNA Library Prep kit (Illumina) ...
-
bioRxiv - Neuroscience 2022Quote: ... a sequence region of 5,000 bp between SnaBI and AgeI restriction sites was amplified using the HiFi amplification kit (Clontech, Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2022Quote: ... Equal volume RNAs were subjected to reverse transcription using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Japan). Distribution of mat mRNAs or mat-exon1 mRNAs in transfected cells was assessed using SBYR-Green (Takara ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized from 500 ng total RNA using a Prime Script RT Reagent Kit (Takara Bio, Otsu, Japan). qRT-PCR was performed using a StepOne Real-time PCR Instrument (Applied Biosystems ...
-
bioRxiv - Physiology 2022Quote: ... Messenger RNAs were reverse transcribed and amplified using the SMART-Seq V4 ultra low input RNA kit (Clontech, France) according to the manufacturer recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 g RNA was used to synthesize the cDNA using reverse transcription M-MLV (RNase-free) kits (TaKaRa, Japan). qRT-PCR was performed with SYBR green PCR master mix (ToYoBo ...
-
bioRxiv - Neuroscience 2021Quote: Reverse transcription (RT) was performed using a PrimeScript® RT Reagent Kit with gDNA Eraser (RR047A, TaKaRa, Dalian, China) in a 20 μL reaction mixture containing 1 μg of total RNA from each individual sample ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Bioengineering 2022Quote: ... and TP–mAG were ligated into the open circular pET-29b(+) using the In-Fusion HD Cloning Kit (TaKaRa) to generate the recombinant protein expression vectors ...
-
Nulliparity affects the expression of a limited number of genes and pathways in Day 8 equine embryosbioRxiv - Developmental Biology 2022Quote: ... Messenger RNAs were reverse transcribed and amplified using the SMART-Seq V4 ultra low input RNA kit (Clontech, France) according to the manufacturer recommendations ...
-
bioRxiv - Developmental Biology 2022Quote: ... https://www.addgene.org/112849/)10 between the EcoRI and SpeI restriction sites by multi-cassette assembly using the InFusion cloning kit (Takara Inc.). The correct sequence of the donor region was validated by Sanger sequencing.
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Molecular Biology 2021Quote: 20 cm plates of HEK293T cells were transfected with 10 µg of each plasmid using CalPhos transfection kit (Takara) according to manufacturer’s instructions and harvested 3 days later ...
-
bioRxiv - Plant Biology 2019Quote: The 5’ ends of the viral genomes sequences were determined or confirmed using the 5’ Rapid Amplification of cDNA Ends (RACE) strategy and internal primers designed from the genomic contigs (Table S1) following the kit supplier’s recommendations (Takara Bio Europe/Clontech ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA Sequencing libraries were prepared with SMARTer® Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR and cDNA synthesis were performed using SMARTer Ultra Low Input RNA Kit v3 following manufacturer’s protocol (Clontech). RNA isolated from 1000 cells was used as starting material ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR and cDNA synthesis were performed using SMARTer Ultra Low Input RNA Kit v3 following manufacturer’s protocol (Clontech). Single cells were used directly as starting material without RNA extraction to avoid extra loss of RNA ...
-
bioRxiv - Neuroscience 2019Quote: ... and CaMPARI was fused to synaptophysin using the In-Fusion® HD Cloning method and kit (Takara Bio USA) after amplifying variants of CaMPARI with PCR using custom primers with base pair overhangs homologous to the synaptophysin plasmid (3’ Primer [CGATAAGCTTTTATGAGCTCAGCCGACC] ...
-
bioRxiv - Biochemistry 2019Quote: ... The PCR product was inserted into the linearized pGL4.17[luc2/Neo] vector by In-Fusion reaction using In-Fusion HD Cloning Kit (Takara). The URAT1/SLC22A12 promoter + pGL4.17 plasmid was transformed into the E ...
-
bioRxiv - Molecular Biology 2021Quote: Input and immunoprecipitated DNA were used to prepare multiplexed libraries using the ThruPLEX® DNA-Seq Kit (Takara Bio) and DNA Unique Dual Index Kit (Takara) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... was collected from 1.0 μg of sheared DNA (median, 200 bp) using an EpiXplore Methylated DNA Enrichment Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA (30 ng) was used for synthesis of cDNA with PrimerScript RT reagent kit with gDNA eraser (TAKARA BIO). QPCR was performed with TB Green Premix Ex-taq II (TAKARA BIO) ...
-
bioRxiv - Genomics 2020Quote: ... 1ng of total RNA was pre-amplified with the SMARTer Ultra Low Input kit v4 (Clontech, Mountain View, CA) per manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: Cell death was assessed by the release of LDH in conditioned medium using LDH Cytotoxicity Detection Kit (TaKaRa, CA).
-
bioRxiv - Plant Biology 2020Quote: ... This was followed by a nested PCR and cloning of the products using the Mighty TA-cloning kit (TaKaRa). Twenty independent clones were randomly picked and sequenced.
-
bioRxiv - Plant Biology 2020Quote: Ptr1 candidate genes were cloned from LA4277-Ro (Ptr1/Ptr1) cDNA into pBTEX (Table S7) using the In-fusion cloning kit manufacturer’s instructions (Takara). StPtr1 was cloned from Dakota Crisp potato plants (Solanum tuberosum ...
-
bioRxiv - Plant Biology 2020Quote: ... as a gBlocks fragment and cloned into pBTEX using the In-fusion cloning kit following the manufacturer’s instructions (Takara).
-
bioRxiv - Plant Biology 2020Quote: ... StPtr1 was cloned from Dakota Crisp potato plants (Solanum tuberosum) into pBTEX via the In-fusion cloning kit (Takara). Nucleotide and amino acid sequences have been deposited in GenBank for Ptr1 from S ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product of the assembled sequence was purified with a DNA Fragment Purification Kit (Takara, Dalian of China) and eluted with ddH2O ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were then prepared using SMARTer Stranded Total RNA-Seq - Pico Input Mammalian Kit (Takara Bio, Kyoto, Japan) according to manufacturers protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries were constructed using the SMART-seq v4 Ultra Low-input RNA sequencing kit with Nextera XT (Takara Bio). Paired-end sequencing was conducted by the UCLA genomic core facility (https://www.semel.ucla.edu/ungc/services) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Messenger RNAs were reverse transcribed and amplified using the SMART-Seq V4 ultra low input RNA kit (Clontech, France) according to the manufacturer recommendations ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5’-RACE and 3’-RACE reactions were performed with the Smart RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... RNAiso™ reagent and PrimeScript ® RT reagent Kit With gDNA Eraser (Perfect Real Time) were purchased from Takara Bio Inc ...
-
bioRxiv - Neuroscience 2021Quote: ... Sequencing libraries were prepared from the amplified cDNA using SMART-Seq PLUS kits (Takara Bio USA, Mountain View, CA). Unique dual indexes were used on the amplified libraries to identify samples ...
-
bioRxiv - Neuroscience 2021Quote: ... High quality samples from matched input and IP fractions were prepared using the (Low-input Library Prep kit (Clontech). Sequenced reads were mapped with STAR aligner (Dobin et al. ...
-
bioRxiv - Cell Biology 2020Quote: RNA libraries from the bulk tissues were prepared using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech, 634888), with a 15 PCR cycles for the amplification step ...
-
bioRxiv - Cell Biology 2020Quote: ... Each capture section was visually confirmed by focusing the PALM on the targeted adhesive cap after the collection session and immediately resuspend in 10.5µl of 1x reaction buffer from SMART-Seq v4 Ultra Low Input RNA Kit (Clontech, 634888). Tissue lysis was achieved by incubation for 5min at room temperature and stored at −20°C ...
-
bioRxiv - Neuroscience 2020Quote: ... The resulting input and neuronal IP samples were used for isolation of total RNA using Nucleospin RNA XS kit according to manufacturer’s protocol (Takara).
-
bioRxiv - Cancer Biology 2021Quote: ... The libraries were prepared using the SMART-Seq® v4 Ultra® Low Input RNA Kit for Sequencing (TaKaRa) followed by Nextera XT (Illumina) ...
-
bioRxiv - Cell Biology 2021Quote: ... The point mutants of Kif7-CC were generated by site-directed mutagenesis using In- Fusion HD cloning kit (Takara). The Kif7 SCC construct (aa488-540 ...
-
bioRxiv - Microbiology 2020Quote: ... or directly cloned into linearized CS-CA-MCS (VLT-ORF63a and VLT-ORF63b) using In-Fusion HD Cloning kit according to the manufacturer’s instruction (Clontech). The primer sets used for cDNA cloning into the CS-CA-MCS plasmid are listed in Supplementary Table 4 ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR reactions were performed with gene-specific forward and reverse primers using the PrimeScript RT-PCR kit (TaKaRa) on the StepOne Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into the XbaI digestion site of pMpGWB301 using In-Fusion HD Cloning Kit (Takara Bio, Shiga, Japan). For construction of proMpYUC2:MpCLE1 ...
-
bioRxiv - Neuroscience 2020Quote: ... and the sequencing library was prepared with SMARTer Stranded Total RNA-Seq Kit v2-Pico Input (Takara, Shiga, Japan), and sequenced with Illumina HiSeq 2500 ...