Labshake search
Citations for Takara Bio :
3551 - 3600 of 5201 citations for Human Luteinizing Hormone Beta Polypeptide LHb CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Immunology 2020Quote: ... The RT products were amplified by nested PCR following the PrimeSTAR® HS DNA Polymerase kit protocol (Takara, Japan), with primers for TCRα and TCRβ ...
-
bioRxiv - Immunology 2021Quote: Cell death was assessed by the release of LDH in conditioned medium using LDH Cytotoxicity Detection Kit (TaKaRa, CA). IL-1β levels in conditioned media were measured by ELISA (eBiosciences ...
-
bioRxiv - Genomics 2021Quote: ... we determined the lentiviral integration site using a protocol adapted from Lenti-X Integration Site Analysis Kit (Takara Bio) and oligonucleotides oJY0104-oJY0109.
-
bioRxiv - Biochemistry 2020Quote: ... Amplified genes were cloned into an altered pFastBacHT B vector using the In-Fusion HD EcoDry Cloning Kit (Clontech). After transformation of DH10EMBacY E ...
-
Guidelines for accurate genotyping of SARS-CoV-2 using amplicon-based sequencing of clinical samplesbioRxiv - Genomics 2020Quote: ... CDC-USA assay targeting gene N (IDT # 10006713) and One Step PrimeScript™ III RT-PCR Kit (TaKaRa #RR600A). Serial dilutions of reference material were prepared ranging from 1 to ~10M genome equivalents per reaction ...
-
bioRxiv - Evolutionary Biology 2020Quote: The water-in-oil droplets after the incubation step were diluted 10000-fold with 1 mM EDTA (pH 8.0) and subjected to RT-qPCR (PrimeScript One Step RT-PCR Kit (TaKaRa)) with primer 1 and 2 after heating at 95 °C for 5 min ...
-
bioRxiv - Genetics 2020Quote: ... Total RNA (1 mg) was reverse transcribed using the PrimeScript RT Reagent Kit with the gDNA Eraser (TAKARA, Japan). Quantitative PCR reactions were performed using the gene-specific primers of FLC and FT (Table S1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was isolated as described above and reverse transcribed into cDNA with the prime Script RT reagent kit (Takara). 10 ng of cDNA was used in a 1X reaction consisting of 12.5 µl TB Green Premix Ex Taq II (Tli RNaseH plus ...
-
bioRxiv - Cancer Biology 2020Quote: ... They are routinely tested for contamination of mycoplasma by using PCR Micoplasma Test Kit (Takara Bio Inc., Shiga, Japan) and confirmed to be negative before performing experiments.
-
bioRxiv - Developmental Biology 2022Quote: ... 30 ZP-free embryos were lysed in 1x Lysis Buffer containing RNase inhibitor (0.2 IU/µl, from SMART-Seq Stranded Kit, Clontech), directly ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... The MSCV wildtype murine ADAR2 overexpression construct was generated using the In-Fusion HD Cloning Plus kit (Takara Bio). Specifically ...
-
bioRxiv - Cancer Biology 2022Quote: Snap-frozen cells were thawed on ice and RNA extracted with Takara’s Nucleospin RNA Plus kit (Takara Cat. # 740984.50) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Cancer Biology 2022Quote: ... MG63.3 libraries were prepared using the Takara SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (Takara, 634411) while 143b-HOS-GFP libraries were prepared using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The measurement was performed after diluting the droplets 100-fold with 1 mM EDTA (pH 8.0) and using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara).
-
bioRxiv - Immunology 2022Quote: ... Library preparation was performed using the ClonTech SMARTer Stranded RNA-SEq Kit V2 for mammalian pico RNA input (Takara) and RNA sequencing was performed using HiSeq 2500 sequencer with 50bp read lengths (Illumina).
-
bioRxiv - Genomics 2022Quote: Sequencing libraries were prepared using 1-10 ng of cfDNA and the ThruPLEX® Plasma-seq Kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA was synthesized from 500 ng total RNA using a Prime Script RT Reagent Kit (Takara Bio, Otsu, Japan). RT- PCR was performed using three primer sets ...
-
bioRxiv - Microbiology 2022Quote: Amplified spike sequence was first gel-purified using NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then further purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2022Quote: ... The titer of the produced lentivirus was determined by using Lenti-X Gostix Plus Titer Kit (Takara, cat# 631281). To generate AMOT knockdown cell line ...
-
bioRxiv - Microbiology 2022Quote: ... Viral load was measured by RT-qPCR using One-Step SYBR® Primescript(tm) RT-PCR kit II (Takara). CT values from serum samples were used to calculate serum viral load according to regression equation built by a set of standard viral RNA extracted from dilutions of known titre virus preparation ...
-
bioRxiv - Microbiology 2022Quote: ... SMART-Seq v4 Ultra Low Input Kit for Sequencing was used for full-length cDNA synthesis and amplification (Clontech), and Illumina Nextera XT library was used for sequencing library preparation ...
-
bioRxiv - Molecular Biology 2022Quote: ... First-stand cDNA was reverse transcribed from 1.5 μg of total RNA using the Prime Script reagent kit (Takara).
-
bioRxiv - Plant Biology 2022Quote: ... ligated into the BamHI and KpnI restriction sites of the pOPINF vector91 using the In-Fusion kit (Clontech Takara) and transformed into chemically competent E ...
-
bioRxiv - Plant Biology 2022Quote: ... ligated into the BamHI and KpnI restriction sites of the pOPINF vector91 using the In-Fusion kit (Clontech Takara) and transformed into chemically competent E ...
-
bioRxiv - Plant Biology 2022Quote: ... The location of T-DNA in mt2 was confirmed by using the GenomeWalker kit (Clontech Laboratories, Mountain View, CA) following the manufacturer’s recommended protocols ...
-
bioRxiv - Plant Biology 2022Quote: ... aril and kernel tissues were pooled equally and cDNA was synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech). Size fractionation and selection (1-2 ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: First-strand cDNA was synthesized from total RNA using the PrimeScript First-Strand cDNA Synthesis Kit with PrimeScript Reverse Transcriptase according to the manufacturer’s protocols (TAKARA). To 1 ug of RNA ...
-
bioRxiv - Neuroscience 2023Quote: cDNA libraries were prepared using the SMARTer® Stranded Total RNA-Seq Kit v2 – Pico Input Mammalian (Takara Bio) following manufacturer’s instructions in ten batches ...
-
bioRxiv - Neuroscience 2022Quote: ... purified RNA samples were converted to cDNA using the SMART-seq v4 Ultra Low Input RNA Kit (Takara Bio), and cDNA libraries were generated with the Nextera XT DNA Library Preparation Kit (Takara Bio ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus was resuspended in cold PBS and titre was determined using Lenti-X p24 Rapid Titre Kit (Takara Bio) according to manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... Total RNA from each sample was extracted and reverse-transcribed to cDNA with PrimeScript RT reagent kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... Total RNA from each sample was extracted and reverse-transcribed to cDNA with PrimeScript RT reagent kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA-seq libraries were prepared using the SMARTer Stranded Total RNA-Seq Kit v2 Pico Input Mammalian (Takara, 634412). Libraries were sequenced on the Illumina MiSeq platform ...
-
bioRxiv - Neuroscience 2022Quote: ... Double stranded complementary DNA (dscDNA) was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Double stranded complementary DNA (dscDNA) was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Microbiology 2022Quote: ... The recombinant adenovirus was prepared in HEK293 cells and purified with an Adeno-X Virus Purification kit (Takara Bio). The purified virus titer was determined using an Adeno-X Rapid Titer kit (Takara Bio) ...
-
bioRxiv - Neuroscience 2022Quote: ... and a subset (approximately 75,000 cells) was pelleted prior to RNA extraction using the NucleoSpin RNA Plus XS kit (Takara) following manufacturer protocol ...
-
bioRxiv - Microbiology 2022Quote: ... cDNAs synthesized from the extracted total RNAs using a PrimeScript™ RT reagent Kit with gDNA Eraser (TAKARA, Japan) were used as templates to perform qPCR assays for the checking of the transcriptions of VEGFA ...
-
bioRxiv - Biochemistry 2024Quote: ... This was followed by ligation of the guide RNA to the ligation oligo using the DNA Ligation Kit (Takara). Subsequently ...
-
bioRxiv - Bioengineering 2024Quote: ... and reverse-transcribed into cDNA using PrimeScript™ RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara Bio). The resulting cDNA was utilized for analysis using TB Green® Premix Ex Taq™ II (Tli RNaseH Plus ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cDNA synthesis and gDNA erase protocol were performed using the PrimeScript RT reagent Kit with gDNA Eraser (Takara). Quantitative real-time RT-PCR (qRT-PCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the remaining RNA isolation was done using the NucleoSpin RNA II Kit (Clontech Laboratories, Palo Alto, CA; 740955.50). 1 μg RNA was transferred into the cDNA Ecodry Premix Kit prior to the quantitative PCR program being run on ABI QuantStudio 3 with iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Genetics 2024Quote: ... cells were harvested and vectors were purified using the AAVpro purification kit (cat.: 6666; Takara Bio, Kusatsu, Shiga, Japan) as per manufacturer’s instructions and stored at -80 °C until further use ...
-
bioRxiv - Bioengineering 2024Quote: ... [50] The ssDNA scaffold was initially prepared using Guide-it Long ssDNA Production System v2 kit (Takara Bio, 632666) following manufacturer’s protocol ...
-
bioRxiv - Biophysics 2024Quote: Lentivirus titration was determined by p24 ELISA using Lenti-X™ p24 Rapid Titer Kit (Takara Bio, no. 632200) and a plate reader (PerkinElmer Victor3 V) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Barcode sequence of each clone was PCR amplified directly from the cells using Terra PCR Direct Polymerase kit (Takara) for Sanger sequencing using previously described primers (5).