Labshake search
Citations for Takara Bio :
3051 - 3100 of 3947 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative real time polymerase chain reaction (qRT-PCR) was performed using SYBR Premix ExTaq (Takara, Japan) in a TP800 Real-Time PCR machine (Takara ...
-
bioRxiv - Neuroscience 2020Quote: ... PCR amplified and inserted into the DsRed-Express2 plasmid using in-fusion cloning (Takara Bio, CA). St3-Halo was generated by replacing the GFP in St3-eGFP with Halo tag (GenScript USA Inc ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR fragments were gel-purified and ligated into the pMD 19-T Vector (TaKaRa, Dalian, China), and confirmed by sequencing from both strands.
-
bioRxiv - Plant Biology 2019Quote: ... fragments were amplified by PCR and ligated using the In-Fusion HD Cloning Kit (Takara Bio). Using RTS 100 Wheat Germ CECF Kit (Roche) ...
-
bioRxiv - Genetics 2020Quote: ... 356-600bp regions encompassing the SNP of interest were amplified using CloneAmp HiFi PCR Premix (Clontech), and then cloned into the pGL4.23-mini/P vector including a minimal SV40 promoter upstream of firefly luciferase ...
-
bioRxiv - Cell Biology 2020Quote: ... gDNA of CFU colonies was extracted by suspending the cell in 1×PCR buffer (Takara, R050A) containing 0.2mg/ml proteinase K (Tiangen ...
-
bioRxiv - Cell Biology 2022Quote: ... TurboGFP was exchanged for eGFP by amplifying the eGFP sequence by PCR from peGFP-N1 (Clontech) using the following primers to introduce AgeI and NotI restriction sites ...
-
bioRxiv - Cell Biology 2021Quote: ... the full-length Borr open reading frame was amplified from LD36125 by PCR using PrimeStar (Takara) and cloned between AscI and NotI sites of pENTR (ThermoFisher ...
-
bioRxiv - Physiology 2021Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Plant Biology 2022Quote: DNA was amplified from cDNA by PCR using PrimeStar GXL DNA polymerase (Takara Bio, Shiga, Japan) and verified by DNA sequencing using a 3130 Genetic Analyzer (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative PCR was performed using TB Green® Premix Ex Taq™ II (Takara, Tokyo, Japan). The siRNA was purchased from Dharmacon and transfected into Raw and PM cells using the DharmaFECT 1 siRNA Transfection Reagent.
-
bioRxiv - Immunology 2021Quote: ... Quantitative real-time polymerase chain reaction (PCR) was performed using TB Green Premix Taq II (TaKaRa) and a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: The cDNA was purified using a NucleoSpin Gel and PCR Clean-up kit (Takara Bio, Inc.). PCR was performed with the cDNA ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Immunology 2020Quote: ... EqPD-1 and EqPD-L1 cDNAs were amplified by PCR using TaKaRa Ex Taq (Takara Bio) and specific primers (Supplementary Table 1) ...
-
bioRxiv - Immunology 2021Quote: ... which involves the following steps: i) cDNA amplification (Terra PCR direct Polymerase, Takara, cat. no. 639270), ii ...
-
bioRxiv - Immunology 2021Quote: ... using the modified (Switching Mechanism At 5’ End of RNA Transcript) PCR cDNA synthesis protocol (Clontech) and oligonucleotides as described below (Table S3) ...
-
bioRxiv - Genomics 2021Quote: ... according to the instructions of SYBR®Green Real-time PCR Master Mix (Takara, Dalian, China). Reaction conditions were 95°C for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR was performed with Advantage-HD DNA polymerase (Takara Bio, Saint-Germain-en-Laye, France) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... and quantitative PCR (qPCR) was performed to detect EGFR levels by using SYBR-Green dye (Takara). Further ...
-
bioRxiv - Genetics 2020Quote: ... Sequencing libraries were made of the 4C PCR products using Thruplex DNA-seq kit (Takara Bio). 4C libraries were subjected to Agencourt AMPure XP Bead cleanup (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... rat Txn1 cDNAs were amplified by PCR using LA-Taq polymerase (Takara Bio Inc, Shiga, Japan) with FW-primer ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR procedure followed the instructions for Tks Gflex DNA polymerase (TaKaRa Bio Inc., Shiga, Japan). The amplified PCR fragments were subcloned into the pGEM T Vector system (Promega Corporation ...
-
bioRxiv - Immunology 2022Quote: ... Real-time PCR analysis was performed using the Probe qPCR Mix (Takara Bio, Otsu, Shiga, Japan) and Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... was subcloned by PCR into Xho1/BamH1 restriction sites of lentiviral expression vector pLVX-puro (Clontech), using 5’ region primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... was subcloned by PCR into Xho1/BamH1 restriction sites of lentiviral expression vector pLVX-puro (Clontech), using 5’ region primer ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Eps8-ΔCAP and IRSp53-mCherry were PCR amplified using PrimeSTAR GXL DNA Polymerase (Takara Bio) and the amplicons were extracted from a 1% agarose gel (Monarch Gel Extraction Kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... was subcloned by PCR into Xho1/BamH1 restriction sites of lentiviral expression vector pLVX-puro (Clontech), using 5’ region primer ...
-
bioRxiv - Genomics 2022Quote: ... Digested samples were column purified using the NucleoSpin Gel and PCR Clean-Up kit (TaKaRa 740609) according to the manufacturer’s directions ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was purified using a NucleoSpin Gel and PCR Clean-up kit (Takara Bio, Inc.). PCR was performed with the cDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were further introduced into the XmnI and KpnI digested pB7FWG2.0 with In-Fusion (Clontech). For dual-luciferase analysis ...
-
bioRxiv - Microbiology 2022Quote: The threshold cycle (Ct) values were determined by the SmartChip Real-Time PCR software (Takara Bio). Standard curves were generated by plotting the Ct values vs ...
-
bioRxiv - Plant Biology 2022Quote: ... Target DNA was amplified by PCR using TaKaRa Ex Taq DNA Polymerase (TaKaRa Bio, Tokyo, Japan). DNA segments were purified using MonoFas DNA Purification Kit I (ANIMOS ...
-
bioRxiv - Neuroscience 2022Quote: ... Target sequences were amplified by 18–30 cycles of PCR using Ex-Taq™ (Takara Bio). For semiquantitative PCR ...
-
bioRxiv - Molecular Biology 2022Quote: We amplified Complementary DNAs (cDNAs) of genes by PCR using PrimeSTAR Max DNA polymerase (TAKARA Bio), and cloned the PCR products into overexpression vectors EGFP-N1 (Addgene ...
-
bioRxiv - Plant Biology 2024Quote: 0.1uL DNA templates were mixed with 10uL Emerald Amp Max PCR Master (Takara Bío. co., Japan) and 0.2uL of 10uM primer set up to 20ul with distilled water for 1st PCR analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... The titer of AAV was determined with a real-time PCR thermal cycler (Dice, Takara Bio). The resultant AAV1-Syn-mCherry (2.8 × 1012 GC/ml) ...
-
bioRxiv - Molecular Biology 2024Quote: ... All constructs were cloned using PCR amplification of complimentary fragments and In-Fusion HD assembly (Takara). pRRL-hPGK-mCherry-P2A-PuroR-T2A-FLAG-APEX2 was created by PCR amplifying hPGK-mCherry-P2A-PuroR-T2A from a synthesised gene fragment purchased from GeneWiz and APEX2 from pcDNA3-FLAG-APEX2-NES (a gift from Alice Ting67 ...
-
bioRxiv - Microbiology 2024Quote: ... Plasma viral RNA copy numbers were determined via SYBR green-based real-time quantitative PCR (Takara), using SIV gag-specific primers (table supplement 4) ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR and CPER reaction were performed using PrimeSTAR GXL DNA polymerase (Takara Bio, Cat# R050A). The CPER product was transfected into BHK/hACE2 cells using Lipofectamine LTX (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Microbiology 2024Quote: ... Viral HA segments were PCR-amplified and cloned into pMD-18T vector (6011, TAKARA Beijing, China). Subsequently ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were constructed by PCR amplification of the whole plasmids with the CloneAmp Hifi polymerase (Takara) and assembly of the insert part with the NEBuilder HiFi DNA Assembly kit ...
-
bioRxiv - Plant Biology 2024Quote: ... The SKI2 cDNA sequence was amplified from wild type cDNA using CloneAmp HiFi PCR Premix (Takara) and cloned into the pPZP212 binary vector ...
-
bioRxiv - Microbiology 2024Quote: ... The HA1 subunit was divided into three fragments for PCR (PrimeSTAR Max DNA Polymerase, Takara Bio), seven Ns and partial sequencing adapters were added in the primer as the barcode ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and extension were all completed with the SMARTer PCR cDNA Synthesis Kit (Takara Bio Europe, France). Full-length cDNA (fl-cDNA ...
-
bioRxiv - Genomics 2023Quote: ... PCR3 products (final library) were purified with the Nucleospin Gel and PCR Cleanup kit (Takara, 740609) and eluted in 25 µL 70 °C buffer.
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Biochemistry 2024Quote: The SUGCT coding sequence was amplified by PCR by using PrimeStar GXL polymerase (Takara Bio Inc) using the following primers (start and stop codon in bold) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...