Labshake search
Citations for Takara Bio :
251 - 300 of 5821 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μL of 2× SYBR Premix Ex Taq II (TaKaRa, Beijing, China), 1 μL of cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the 5’ end was used and the 3’ of TciALDO cDNA was obtained by 3’ RACE (SMARTer RACE cDNA Amplification Kit, Clontech) using T ...
-
bioRxiv - Immunology 2022Quote: ... or the expression vector LentiCRISPRv2 (coding for guideRNA) in a 3:1:3 ratio for 8 hours using calcium phosphate transfection (CalPhos Mammalian Transfection Kit, Takara Bio Europe ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... 3 μl of each dilution was then spotted on a SD-Leu-Trp plate (ST0048, Takara Bio, USA) as a growth control ...
-
bioRxiv - Cell Biology 2022Quote: ... Flt3 ligand (50 ng/ml) and IL-3 (20 ng/ml) onto plates coated with retronectin (Takara Bio).
-
bioRxiv - Cancer Biology 2024Quote: ... Retroviral transduction was achieved by spinoculation of 3 × 106 mouse T cells on retronectin-coated plates (Takara Bio) with neat retroviral supernatant harvested from 293T packaging cells (2000xg ...
-
bioRxiv - Biochemistry 2020Quote: ... and cell toxicity was evaluated using the LDH Cytotoxicity Detection Kit (Cat #MK401; Takara Bio, Shiga, Japan).
-
bioRxiv - Microbiology 2023Quote: Amplification and detection were performed using the One Step PrimeScript™ RT-PCR Kit (RR064A, Takara Bio) with the following primers targeting the IAV M segment ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by a T7 endonuclease I (T7EI) assay using the Guide-it Mutation Detection Kit (Takara Bio) following the standard protocol for mismatch detection.
-
bioRxiv - Cell Biology 2022Quote: All plasmid fusions assembled in-house were generated through standard ligation-based methods using the In-Fusion cloning kit according to manufacturer protocols (Takara, 638920). MBNL1 RNA-interaction and chelation mutant sequences were designed based on plasmids generated by Andrew Berglund (Purcell et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... the transfer plasmid (pBABEpuro-based or pLZRS-IRES-ΔNGFR/GFP-based) and pCMV-VSV-G were co-transfected into GP2-293 packaging cells using CalPhos mammalian transfection kit (Takara/Clontech) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutated 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 2× SYBR Green qPCR Mix Kit (TaKaRa, Japan) and the cDNA concentration and primers described above were used ...
-
bioRxiv - Immunology 2022Quote: ... before amplification using the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Bioengineering 2023Quote: ... quantified via qPCR (AAVpro Titration Kit version 2; Clontech), and stored at 4°C until use.
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the Advantage® 2 PCR Kit (Takara Bio) in a touchdown cycling program as follows ...
-
bioRxiv - Evolutionary Biology 2019Quote: Templates for mRNA in situ hybridization probes were cloned by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA or genomic DNA (see Supplemental File 1 for details) ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Plant Biology 2023Quote: ... The reaction medium contained 2 µL of 5× In-Fusion HD Enzyme Premix (Clontech); 1 µL of linearized pFL61[GFP] (∼100 ng) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were single-cell sorted into 96-well low-bind PCR-plates [Eppendorf] containing 3 μl of lysis buffer (0.5 units/μl RNase inhibitor [Takara] ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected with pLVX-based lentiviral plasmids (Takara Bio), modified to express human histone H2B tagged at the N-terminus with GFP (pLVX-myc-EmGFP-H2B ...
-
bioRxiv - Cell Biology 2021Quote: Inducible gene expression system based on Tet-On 3G (Clontech) was employed ...
-
bioRxiv - Cell Biology 2023Quote: ... Y2H studies were based on the Yeast protocols handbook (Clontech, Protocol No ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... The RNA was eluted according to the protocol in 10 uL nuclease free water and equal amounts of RNAs from different samples were immediately subjected to amplification-based cDNA synthesis using the SMARTer PCR cDNA Synthesis Kit (Takara, 634925, 639207). We have standardized the amplification cycle to 15 for 2-10 ng of initial RNA template used for the reaction ...
-
bioRxiv - Microbiology 2022Quote: ... Release of LDH into the culture supernatant was quantified after infection using an LDH Cytotoxicity Detection Kit (Clontech). LDH release was normalized to mock-infected cells and cells treated with 1% Triton to establish maximum LDH release ...
-
bioRxiv - Physiology 2022Quote: ... Media lactate dehydrogenase (LDH) was assayed by enzymatic colorimetric assay (LDH Cytotoxicity Detection Kit, Takara Bio, cat# MK401).
-
bioRxiv - Cancer Biology 2022Quote: ... DNA fragmentation was performed using In situ Apoptosis Detection Kit according to the manufacturer’s indications (Takara Bio Inc.). For immunostaining ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Plant Biology 2020Quote: The assay was performed using the 5’-Full RACE kit (TaKaRa) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Immunology 2021Quote: ... 5’ RACE was performed with SMARTer RACE cDNA Amplification Kit (Clontech). IgG /IgK/IgL NGS libraries were made by using NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µL of the ligation mix (Takara Ligation Kit 6023), and then placing the tubes into a heat block at 90 °C for 15 min ...
-
bioRxiv - Neuroscience 2019Quote: ... Amplification was performed using Advantage GC 2 PCR kit (Clontech) and PCR products were cloned and sequenced.
-
bioRxiv - Biochemistry 2022Quote: ... restriction enzymes and DNA ligation kit ver.2 (Takara Bio); pET21a and E ...
-
bioRxiv - Immunology 2021Quote: Cell death was assessed by the release of LDH in conditioned medium using LDH Cytotoxicity Detection Kit (TaKaRa, CA).
-
bioRxiv - Immunology 2021Quote: Cell death was assessed by the release of LDH in conditioned medium using LDH Cytotoxicity Detection Kit (TaKaRa, CA). IL-1β levels in conditioned media were measured by ELISA (eBiosciences ...
-
bioRxiv - Developmental Biology 2023Quote: ... RT-qPCR detection was performed on each group of samples by using a reverse transcription kit (Takara Bio, Japan) and fluorescence quantitative kit (Takara Bio ...
-
bioRxiv - Cell Biology 2023Quote: Cell death was assessed by the release of LDH in conditioned medium using LDH Cytotoxicity Detection Kit (TaKaRa, CA). IL-1β levels in conditioned media were measured by an ELISA kit (eBiosciences ...
-
bioRxiv - Microbiology 2022Quote: ... Make Your Own “Mate & Plate™” Library System and Yeast Transformation System 2 were purchased from TaKaRa. Synthetic-defined (SD ...
-
bioRxiv - Cell Biology 2021Quote: The peGFP-RAD51AP1 expression vector is based on peGFP-C1 (Clontech) and has been described previously (Modesti et al ...
-
bioRxiv - Microbiology 2021Quote: ... Gal4-based two-hybrid screening against the mouse cDNA library (Clontech) was performed as described before (Mitsuzawa et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative real-time PCR using SYBR Green based method (DSS TAKARA) was employed to estimate relative transcript levels of mRNAs with GAPDH as housekeeping control gene for internal normalization ...