Labshake search
Citations for Takara Bio :
101 - 150 of 5821 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using a QuantStudio 1 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The viral RNA copy number was standardized using a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals from resulting PCR products were acquired using a Thermal Cycler Dice Real Time System III (Takara).
-
bioRxiv - Plant Biology 2021Quote: Transcription start sites were characterised by cloning and sequencing 5’ RACE products using the SMARTer RACE 5’/3’ kit (Takara Bio USA, Inc). In summary ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Microbiology 2021Quote: ... at 30°C for 3-5 days and assayed for growth on the SD/-Trp/-Leu/-His/-Ade/X-α-gal plates (TaKaRa Bio). Each experiment was repeated at least three times.
-
bioRxiv - Evolutionary Biology 2021Quote: First amplified with primers 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) using EmeraldAmp GT PCR Master Mix (TAKARA BIO) to minimize the amplification of non-bacterial taxa under the following cycling conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Cell Biology 2019Quote: ... The LDH cytotoxicity detection kit was purchased from Clontech and used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The copy number of viral RNA was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, cat# RC300A). The fluorescent signal was acquired using a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... The copy number of viral RNA was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). The fluorescent signal was acquired using a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2022Quote: We used the GAL4-based Matchmaker Gold Yeast 2-Hybrid System (Clontech, Mountain View, California) for all Y2H and Y3H assays ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Biochemistry 2019Quote: ... cochleariae fat body for 3’ rapid amplification of cDNA ends (3’ RACE) was synthesized according to the manual from SMARTer RACE 5’/3’ Kit (Takara Bio, Inc. Mountain View, CA, USA). All cDNA templates were stored at −20 °C after synthesis.
-
bioRxiv - Developmental Biology 2022Quote: ... 5’ and 3’ RACE ready cDNA was generated from a pooled female pupal RNA sample and also from a pooled adult female ovary sample (RNA extracted using RNeasy MinElute kit, RACE conducted using SMARTer 5⍰/3⍰ RACE kit - Takara Bio, Kyoto, Japan). Visible bands were cloned using the NEB PCR cloning kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... The cDNA samples were subjected to quantification by real-time PCR with specific primers F (5’-GATTACCAGGGATTTCAGTCG-3’) and R (5’-GACACCTTTAGGCAGACCAG-3’) using SYBR ® Premix Ex TaqTM II (Tli RNaseH Plus) (TaKaRa Cat: RR820A). Fold change in RNA was calculated by double-standard curve methods and β-actin as an internal control.
-
bioRxiv - Microbiology 2023Quote: ... which was amplified by PCR from human cDNA using primers forward (5’-CAGTGTGGTGGAATTCACCATGTCAAGCTCTTCCTGGCT-3’) and reverse (5’-CACAAGATTTGGGCTCGGAAACAGGGGGCTGGTTAG-3’) and cloned into plasmid pVAX-IGHG1ΔCH1 by In-Fusion cloning (Takara Bio, San Jose, CA). This plasmid contains an Fc domain comprising Kabat numbers 226-478 of human IgG1 ...
-
bioRxiv - Immunology 2019Quote: ... Cell-death was assayed using LDH Cytotoxicity Detection Kit (Takara). To normalize for spontaneous lysis ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5’-RACE and 3’-RACE reactions were performed with the Smart RACE cDNA Amplification Kit (Clontech, Palo Alto, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: The sequence of anti-IFNγ was cloned from XMG1.2 hybridoma (ATCC) using SMARTer RACE 5’/3’ kit (Takara Bio). The 6xHis tagged anti-Dsg ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV was purified 3–5 days after transfection using AAVpro Purification Kit Midi or Maxi (Takara Bio, Shiga, Japan). The viral concentration was measured by qRT-PCR.
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Immunology 2019Quote: CpG-ODN 2007 (5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’) were synthesized by Takara Biotechnology (Dalian ...
-
bioRxiv - Neuroscience 2019Quote: ... The calcium phosphate-based CalPhos Mammalian Transfection Kit (631312, Clontech Laboratories, Mountain View, CA) was used (Harata et al. ...
-
bioRxiv - Pathology 2020Quote: ... The PCR assay was conducted as described previously9 and the complete genome termini was determined using the Takara SMARTer RACE 5’/3’ kit (TaKaRa) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA was generated from 1 μg of RNA for each sample using the SMARTer RACE 5’/3’ Kit (Takara Bio ...
-
bioRxiv - Immunology 2020Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc., Mountain View, CA) using primers with specificity to IgM ...
-
bioRxiv - Cell Biology 2022Quote: ... a polymerase chain reaction using 5’-TCTAGAGCTACTAACTTCAGCCTGCTG-3’ / 5’ - CGGTGGATCCCCTTCTTCC-3’ primers on Ibidi USA 60101 LifeAct-GFPtag2 plasmid was cloned with In-Fusion HD enzyme kit (Takara) into the pLVX vector (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... LDH release was quantified using an LDH Cytotoxicity Detection Kit (Clontech) according to the manufacturer’s instructions and normalized to mock-infected cells.
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed with SYBR green detection kit (Takara, Japan) and ABI 7500 RT-PCR system (Applied Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... we used an In situ Apoptosis Detection Kit (Takara Bio, MK500).
-
bioRxiv - Microbiology 2020Quote: ... LDH release was quantified using an LDH Cytotoxicity Detection Kit (Clontech) according to the manufacturer’s instructions and normalized to mock-infected cells.
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... genomic DNA was isolated using Guide-it Mutation Detection Kit (Takara). DNA fragments flanking the targeted Drd1a locus and off-targets (Figure S4C ...
-
bioRxiv - Microbiology 2023Quote: ... LDH release was measured using an LDH Cytotoxicity Detection Kit (Clontech) according to the manufacturer’s instructions and normalized to mock-infected cells.
-
bioRxiv - Microbiology 2023Quote: ... LDH release was quantified using an LDH Cytotoxicity Detection Kit (Clontech) according to the manufacturer’s instructions and normalized to mock-infected (min cytotoxicity ...