Labshake search
Citations for Takara Bio :
151 - 200 of 5821 citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Evaluation of protein interactions by the GAL4-based Y2H system was performed by following the manufacturer’s recommendations for the Matchmaker GAL4 Two-hybrid System 3 (Clontech, USA). Competent AH109 yeast cells (Clontech ...
-
bioRxiv - Microbiology 2022Quote: ... sacB was amplified using pAJF067 as a template and primers listed in Supplementary Table 3 and were cloned into pDB60 digested with EcoR1 using recombination based cloning (In-Fusion, Takara). For dinB2 and dinB3 overexpression plasmids constructs ...
-
bioRxiv - Genomics 2020Quote: ... Transcripts rising from the identified TSS were determined using the SMARTer Rapid amplification of cDNA ends (RACE) 5’/3’ kit (Takara Bio) in accordance with the manufacturer’s instructions for 3’ RACE ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5’ and 3’ RACE was carried out according to the manufacturer’s protocol of SMART RACE cDNA Amplification kit (Clontech, Takara, Japan). The sequences of primers for RACE are as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... was extracted and 5’ and 3’ rapid amplification of cDNA ends (RACE) was performed using the Smarter RACE kit (Clontech, 634858). cDNA was synthesized as described in the kit using 5′ and 3′ RACE CDS primers and SMARTer IIA oligo for template switching for 5′ RACE ...
-
bioRxiv - Immunology 2021Quote: ... the isolated RNAs were subjected to first-strand cDNA synthesis using (5’-GTCGTATCCAGTGCAGGGTCCGAGGTCACTG GATACGACATACAACA-3’) by PrimeScriptTM II 1st Strand cDNA Synthesis Kit (Takara, Japan). After that ...
-
bioRxiv - Cell Biology 2021Quote: ... zroraa LBD deletion DN -: 5′- ctgattatgatctagagtccaggccggattgatcagg-3 and inserted into a Tol2-lyzC-mcherry-2A backbone by using infusion cloning kit (Takara #638920). The construction method for neutrophil-specific Cas9 expression and the guide RNA expression fish lines has been described in our previous study [40] ...
-
bioRxiv - Plant Biology 2023Quote: ... the correct full-length sequences were determined for the laboratory strains using a SMARTer RACE 5’/3’ kit (Takara, Shiga, Japan). These sequences were aligned by ClustalW ...
-
bioRxiv - Biophysics 2023Quote: ... 5’-CTGGAGAATCCCGGTGC-3’ and 5’- GTGTCAGATATATACATCCTGT-3’ and the PCR product was purified using a NucleoSpin Gel and PCR Clean-up Maxi kit (Takara Bio). The sequences of the 147 bp and 177 bp DNA are as follows:
-
bioRxiv - Developmental Biology 2019Quote: ... 3Flag-BMAL1 and 3HA-CNOT1-C were transfected by the calcium phosphate-based kit (Clontech) in 10cm plates of HEK293T cell cultures ...
-
bioRxiv - Neuroscience 2019Quote: ... using the calcium phosphate-based CalPhos Mammalian Transfection Kit (631312, Clontech Laboratories, Mountain View, CA) (Harata et al. ...
-
bioRxiv - Physiology 2021Quote: ... Purified AAVs were titered using a qPCR based kit (Cat. No. 6233; Takara Bio, USA). The TA muscle of each mouse received a 5 x 1010 vg of either AAV-GFP or AAV-CAAHR using several small volume (~7-8 μl ...
-
bioRxiv - Immunology 2022Quote: ... into 96-well plates containing 2 µL Lysis Buffer (Clontech) supplemented with 1 U/μL RNase inhibitor (NEB) ...
-
bioRxiv - Immunology 2021Quote: ... LDH release was quantified using an LDH Cytotoxicity Detection Kit (Takara BioProduct) according to the manufacturer’s instructions and normalized to mock-infected cells.
-
bioRxiv - Immunology 2022Quote: ... Lactate dehydrogenase activity was quantified using the LDH Cytotoxicity Detection Kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a luminometric β-galactosidase detection kit (Takara Bio, Palo Alto, CA) following the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2022Quote: Following the transfer of samples into a 384-well plate containing RT-PCR buffer with 3’ SMART-Seq CDS Primer IIA (SMART-Seq® v4 PLUS Kit, TaKaRa, cat# R400753); the samples were immediately denatured at 72ºC for 3 min and chilled on ice for at least 2 min ...
-
bioRxiv - Microbiology 2021Quote: ... were transduced into TCR-deficient Jurkat cells or primary T-cells using the Plate-GP and PG13 cell-based retrovirus system and Retronectin (Takara Bio) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... a lentivirus vector encoding doxycycline inducible NET23/ STING fused to GFP at the C-terminus (pLVX-TRE3G backbone, Clontech) was prepared by standard procedures and transduced into HT1080 cells ...
-
bioRxiv - Cell Biology 2019Quote: ... a pFA6a-3’UTR-AfeI-5’UTR-scd2-kanMX-3’UTR (pSM2255) plasmid was generated by InFusion cloning (Clontech) of a pFA6a-based plasmid containing the yeast kanMX resistance cassette digested with KpnI and AscI ...
-
bioRxiv - Plant Biology 2022Quote: CRISIS2 or Nb14-3-3 was fused with the Gal4 DNA binding domain in pGBKT7 (Clontech, PT3248-5, USA) and inserted into the Saccharomyces cerevisiae Y2HGold strain (Clontech ...
-
bioRxiv - Microbiology 2023Quote: The pEGFP-C1 plasmids including AFF4 3’UTR sites “1-2-3” were generated using pEGFP-C1 (Clontech). The following complementary oligonucleotides were annealed in respective pairs as above (1.25 µM each in 75 mM NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... 250 ng of RNA isolated from each condition was converted into cDNA and processed through the SMARTer® 5’/3’ RACE Kit (Takara Bio) for 5’-RACE following manufacturer protocols ...
-
bioRxiv - Biochemistry 2020Quote: Complementary DNA (cDNA) was generated from previously extracted total RNA (900 ng) using the SMARTER RACE 5’/3’ kit (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: 5’ and 3’ RACE reactions were performed to isolate full-length lncEry from the total RNA of MEP cells using the 5’- and 3’-Full RACE Kits (TaKaRa, Dalian, China) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Zoology 2019Quote: ... the cDNA ends of both genes were obtained via 5’- and 3’-RACE using the SMARTer™ RACE cDNA amplification kit (Clontech, USA). Resulting PCR products were directly sequenced and full-length cDNAs of the putative mudskipper desaturase and elongase were constructed by aligning overlapped regions of the cDNA fragments.
-
bioRxiv - Cell Biology 2021Quote: ... 5-AAC TTC GCG CTT CCT AAG TCC CCG AAG GA-3 using Prime STAR mutagenesis kit (Takara Bio Inc. Shiga, Japan). GFP-Rab27a was purchased from RikenBRC(Tsukuba ...
-
bioRxiv - Genetics 2020Quote: ... The 5’ and 3’ end of the viral genome was amplified by rapid amplification of cDNA ends by using the 5’ and 3’ Smarter RACE kit (TaKaRa, Dalian, China).
-
bioRxiv - Immunology 2022Quote: Extracted RNA was thawed on ice and converted to first strand complementary DNA (cDNA) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA), as described by the manufacturer and a custom oligonucleotide that contained the template switch oligo and a unique molecular identifier (5’ TSO-UMI ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Plant Biology 2020Quote: ... The transformants were grown on SD -Trp plates (Clontech, 2% agar) for selection ...
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 2 ug Retronectin (TaKaRa Cat. no. T110A), 1 ug anti-mouse CD11a (LFA1) ...
-
bioRxiv - Plant Biology 2023Quote: The LexA-based Y2H system (Clontech) was used for protein interaction analysis ...
-
bioRxiv - Immunology 2023Quote: Based on the pEGFP.C1 vector (Clontech) plasmids for the CMV promoter-driven expression of fusion proteins of GFP with either only the inhibitory receptor cytoplasmic domain or the joint transmembrane plus cytoplasmic domain were generated ...
-
bioRxiv - Biochemistry 2023Quote: ... Cobalt-based affinity resins (Talon, Clontech) were used to capture target proteins with an N-terminal His-tag ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... VSV G-pseudotyped HIV-1 using full-length HIV-1 molecular clone pNL4-3 [79] or the R5-tropic pNL4-3 AD8 derivative [80] and VSV-G envelope encoding plasmid (PT3343-5, Clontech); 4 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The FOXR1 wild-type and M280L mutant were then PCR amplified using forward 5′-AAAGCACTCGAGATGGGGAACGAGCTCTTTCTG-3’andreverse5’-TTTGGCCCGCGGTTAAAGATCAAAGAGGAAGGG-3’ primers and subcloned into the XhoI and SacII restriction sites of pEGFP-C3 (Clontech) to create an N-terminal EGFP tag ...
-
bioRxiv - Cell Biology 2020Quote: ... with 5’-cgGAATTCaccATGgagcagaagctc atctcagaagaagacctcggtAAGGATAACACCGTGCC-3’ and 5’-ataagaatGCGGCCGCtaaact ATTATTTTTCTGCACTACGCAGG-3’ followed by cloning into the EcoRI and Not I sites of pIRESpuro3 (Clontech) creating pIRESpuro3-myc-BirA ...
-
bioRxiv - Microbiology 2019Quote: ... Lentiviral titer was estimated using the GoStix rapid lentiviral titer detection kit (Takara Bio Europe SAS ...
-
bioRxiv - Plant Biology 2021Quote: ... and mutations were detected using the Takara Guide-it Mutation Detection Kit (Takara). PCR products from positive plants were cloned in the cloning vector pTZ57R/T and sequenced using M13F and M13R primers ...
-
bioRxiv - Microbiology 2020Quote: ... 1) were annealed to a complementary 20-nt primer containing a 5’-fluorescein label (5’FAM-GUCAUUCUCCUAAGAAGCUA-3’, Takara). To perform the primer extension assay ...
-
bioRxiv - Genetics 2022Quote: The 3’end of the cloned fragment was amplified with a 3’RACE kit (Takara). RNA from fresh soybean roots was used as the template ...
-
bioRxiv - Microbiology 2021Quote: 5’-RACE PCR was performed on total RNA from VSVg-NL43 infected CD4+ T cells and MDMs following the manufacturer’s protocol for SMARTer® RACE 5’/3’ Kit (Takara Bio, Cat: 634858). Random primers were annealed to template RNA using 10X Random Primer Mix ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 were determined by DNA gel extraction and sequencing after rapid amplification of cDNA ends (RACE) using the SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and internal primers designed from P ...
-
bioRxiv - Plant Biology 2023Quote: The 5’ and 3’ experiments were conducted with the use of SMARTer® RACE cDNA Amplification Kit (Takara Bio, United States, Cat# 634860) and Advantage Polymerase as described by Kruszka et al ...
-
bioRxiv - Genomics 2024Quote: ... Library construction was performed based on the manufacturer’s recommendation for SmarterStranded V2 kit (Takara Bio, California, USA). The final library quantity was measured by KAPA SYBR FAST qPCR and library quality was evaluated by TapeStation D1000 ScreenTape (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Neuroscience 2023Quote: ... The qPCR reaction was performed on 96-well plates in a final volume of 12 μL using the Premix Ex Taq Probe based qPCR assay (Takara Biotechnology, ref. RR390A). All reactions were run in duplicate on a StepOnePlus Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... (5’-GGT CTC TCT GGT TAG ACC AGA TCT GAG C-3’ and 5’-AAA CAT GGG TAT TAC TTC TGG GCT GAA AG-3’) using PrimeSTAR®HS (TAKARA) and purified by QIAquick Gel Extraction (QIAGEN) ...