Labshake search
Citations for Takara Bio :
2451 - 2500 of 6736 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... The bisulfite-converted library was split between two 50 ul reactions and PCR amplified using the following conditions: 2.5 U of ExTaq DNA polymerase (Takara Bio), 5 μl of 10X Extaq reaction buffer ...
-
bioRxiv - Microbiology 2023Quote: ... Fragments encoding the CD45 extracellular domain (ECD) and transmembrane region were amplified by PCR and cloned into pEGFP-N1 (Clontech) using the EcoRI and BamHI restriction sites ...
-
bioRxiv - Microbiology 2023Quote: ... inverse PCR amplification was conducted with oligonucleotides and templates listed in Table S1 and the resulting PCR products were treated with T4 Polynucleotide Kinase (Takara) and ligated with a DNA ligation kit (Takara) ...
-
bioRxiv - Plant Biology 2023Quote: ... Synthesized cDNA was amplified by real-time quantitative PCR (qPCR) with TB Green Premix Ex Taq (Tli RNaseH Plus) (Takara) using the QuantStudio 3 system (Applied Biosystems) ...
-
bioRxiv - Zoology 2023Quote: ... primers were designed on each scaffold using Primer3Plus (https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) (Table S3) and PCR was performed using PrimeSTAR Max DNA Polymerase (Takara Bio, Shiga, Japan). The sequences of the PCR products ...
-
bioRxiv - Neuroscience 2022Quote: ... the PCR fragments containing InDels were cloned into pL253 at the NotI and SpeI sites via InFusion cloning (Takara #ST0344). Bacterial recombinants were screened via PCR using primers 253.S (caaggcgattaagttgggtaac ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNAs (1-5 ng RNA equivalents) were used for real-time PCR amplification using SYBR Premix Ex Taq II (Takara/Clontech) on a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Bioengineering 2022Quote: ... The solution was heated at 65°C for 5 minutes using Takara® PCR Thermal Cycler (Takara Corp., Shiga, Japan), and then gradually cooled down to 30°C over a time span of 10 minutes before settling down to 4 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... qRT–PCR was performed using SYBR Premix Ex TaqII (Tli RNaseH Plus) and the Thermal Cycler Dice Real Time System (TaKaRa). The data were normalized using 18S rRNA as a reference ...
-
bioRxiv - Plant Biology 2024Quote: ... The genomic DNA sequences surrounding the potential off-target sites selected for further analysis (Table 2) were amplified by PCR using specific primers (Supplementary Table S1) and PrimeSTAR GXL DNA Polymerase (Takara) from CRISPR/Cas-edited hairy roots (R1 of E-CP1 [the main root and five lateral roots] ...
-
bioRxiv - Microbiology 2023Quote: ... Genes or gene fragments were PCR amplified with primers (S2 Table) to allow for In-Fusion gene cloning (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... The qPCR reactions were carried out and the signals were detected using a real time PCR system (catalog no. TP950, TaKaRa). For RT-qPCR ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and IV from M13cp following PCR amplification and ligation using the In-Fusion Snap Assembly Master Mix (Takara Bio, 638944). The resulting helper plasmids were transformed into DH5α competent cells (NEB ...
-
bioRxiv - Plant Biology 2024Quote: ... coli and verified the expression cassette by sequencing and repeated again this yeast two hybrid assay by using the verified plasmid DNA instead of the corresponding PCR fragment inserts and linear vectors for mbSUS interaction tests as described “mbSUS tests protocol” (Clontech).
-
bioRxiv - Molecular Biology 2024Quote: The RBD-DsRed plasmid was created by PCR cloning the HB domain of RNAse H1 into the pDsRed-Express-C1 vector (Clontech), following the previously described method [32].
-
bioRxiv - Neuroscience 2024Quote: ... The tdTomato-tagged Tmem120a construct was generated by PCR cloning Tmem120a using the Origene MR205146 clone as a template and subcloning it to the ptdTomato-N1 vector (Clontech), placing the tdTomato tag to the C-terminus of Tmem120a8 ...
-
bioRxiv - Plant Biology 2023Quote: ... reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) was employed using the SYBR Green PCR Master Mix (Takara, Dalian, China) in a 48-well plate and analysed using a StepOne Real-Time PCR system (PE Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... pLVXE-Blast::mCherry-TagRFP-Luciferase (RFP-cyto) was constructed by PCR and ligation of mCherry-TagRFP-Luciferase from 2xRFP-luciferase into a pLVXTight lentiviral vector (Clontech) previously modified to contain the EF1a promoter and blasticidin resistance.
-
bioRxiv - Cancer Biology 2024Quote: ... Eukaryotic expression vectors encoding green fluorescent protein (GFP)-tagged proteins were generated by inserting PCR-amplified fragments into pd1-EGFP-N1 vector (6073-1, Clontech). Prokaryotic plasmids encoding GST-fusion proteins were constructed using pGEX-4T-1 bacterial expression vector (27-4580-01 ...
-
bioRxiv - Immunology 2024Quote: The full-length cDNA of mouse CCL2 (NM_011333.3) was amplified by PCR with PrimeSTAR Max DNA Polymerase (Takara Bio, #R045A) from mouse MCP-1/CCL2 cDNA ORF Clone (Sino Biological ...
-
bioRxiv - Biochemistry 2023Quote: ... The PCR product was inserted into a BamHI and XhoI double-digested pGEX-6P-1 vector using InFusion Snap Assembly (Takara), resulting in the expression construct for GST-3C-GCP21-110 (referred to as “GST-GCP2-NHD”) ...
-
bioRxiv - Neuroscience 2023Quote: Mammalian expression constructs were mainly generated by Gibson assembly of PCR-amplified coding sequences (primers, Supp. Data File 2) into restriction-digested pC1 (CMV promoter, modified from pEGFP-C1, Clontech) or pCAG (CMV enhancer fused to chicken beta-actin promoter ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μg of genomic DNA per sample was used as template for PCR to amplify the sgRNA region using Ex Taq DNA polymerase (Takara). Next Generation Sequencing (NGS ...
-
bioRxiv - Immunology 2022Quote: ... Sequences encoding DCFHP (residues 1-1146 of HexaPro)2 and SΔC-Fer (residues 1-1143 as previously described)3 were cloned into the pADD2 vector backbone using HiFi PCR (Takara) followed by In-Fusion (Takara ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genes were analysed by quantitative real-time PCR in triplicate with at least three independent biological replicates using SYBR premix EX Taq (Takara). Quantification was performed as indicated in the figure legends ...
-
bioRxiv - Plant Biology 2023Quote: ... were PCR-amplified and fused to a nuclear localization signal (NLS) in pENTR vectors using In-Fusion HD Cloning Plus (Clontech). See Table S5 for primer details ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative real-time RT-PCR analysis was performed using TB Green Premix Ex Taq (Clontech, RR420A, Mountain View, CA, USA). The following diluted primers were used ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA copies of IBVs were quantified by real-time PCR using TB Green Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa) and the following primer pair ...
-
bioRxiv - Bioengineering 2023Quote: ... with each 20 μl of PCR mixture containing 10 μl of TB Green Premix Ex Taq II (Tli RNase H Plus, Takara), 0.4 μl of each PCR forward and reverse primers (10 μM) ...
-
bioRxiv - Cell Biology 2022Quote: ... RNAi-resistant full length LIC1 and LIC2 and LIC1 truncations were generated by PCR and restriction digest cloning into pEGFP-C3 (Clontech) and used for rescue experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length and truncated Cntn1 was PCR amplified from rat contactin-myc 34 and ligated together using an In-Fusion Snap Assembly Master Mix (Takara). All DNA constructs were verified by sequencing (Genewiz and plasmidsaurus).
-
bioRxiv - Cell Biology 2023Quote: candidate factors were prepared by subcloning the ORF template clones by PCR amplification with Prime STAR GXL DNA polymerase (Takara) and ligation by In-Fusion cloning enzyme (Clontech).
-
bioRxiv - Cell Biology 2022Quote: ... Wild-type iRhom2 and iRhom2-1-374 were also cloned by PCR into pM6P.Blasticidin (for retroviral infection) and into pLVX-TetOne-Puro vector (Clontech, #631849) (for lentiviral infection) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Wildtype and mutant constructs were then PCR amplified using primers to encompass HA-EZH2 + add NotI and PacI for subcloning into pQXCIH (Clontech). See Supplemental Table 1 for the primer sequences ...
-
bioRxiv - Immunology 2022Quote: The full-length sequences of sea perch RNF34 (GenBank accession number: OP784387) was amplified by PCR using primers (S1 Table) and was subsequently cloned into pCMV-Flag/Myc vector (Clontech). RNF34 deletion mutants (RNF34ΔRING and RNF34ΔZinc ...
-
bioRxiv - Biochemistry 2023Quote: ... 2019) and ACOT8 (ACOT8 H78A) (Ishizuka et al., 2004) were constructed by PCR-mediated mutagenesis using PrimerSTAR DNA polymerase (Takara). cDNAs for proteins expression were constructed in pLV cs2.0 vectors ...
-
bioRxiv - Immunology 2023Quote: ... These three segments were ligated sequentially by overlap PCR and inserted into XhoI/NotI linearized Phr-SIN vector by In-fusion cloning (Clontech) to produce full length CD1d SCD ...
-
bioRxiv - Microbiology 2023Quote: The component concentration of each reaction mix included 10μL of 2X EmeraldAmp® GT PCR master mix (Takara Bio, Japan), 1μL (0.5μM ...
-
bioRxiv - Microbiology 2023Quote: ... pAAV-UGI was constructed by cloning the entire coding sequence of UGI amplified from pBS-UGI-flag by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pAAV-ZsGreen1 (TaKaRa).
-
bioRxiv - Biochemistry 2023Quote: ... followed by an SGG linker and then the ferritin protein1 were cloned into the pADD2 vector backbone using HiFi PCR (Takara) followed by In-Fusion (Takara ...
-
bioRxiv - Genetics 2023Quote: ... the sequences corresponding to Flag tags were replaced by those encoding for Myc tags using the In-Fusion PCR cloning system (Takara) according to the kit’s guidelines ...
-
bioRxiv - Plant Biology 2023Quote: ... The qRT-PCR was performed by using the TB Green Premix Ex Taq (Tli RNase H Plus; TaKaRa, Cat. #RR420A) and CFX Connect Real-Time system (Bio-Rad) ...
-
bioRxiv - Biophysics 2023Quote: Sublibraries of different regions of SLC22A1 were PCR amplified using primer-specific and polymerase (PrimeStar GXL DNA polymerase) (Takara Bio). A total of 11 regions were PCR amplified ...
-
bioRxiv - Microbiology 2023Quote: PCRs were conducted over 35 cycles and were based on TaKaRa Ex Taq Hot Start polymerase chemistry (Takara Bio, USA). For 16S rRNA gene amplification ...
-
bioRxiv - Genomics 2023Quote: A putative enhancer region encompassing approximately 550 bp on either side of each proxy SNP was identified and amplified using PCR for infusion cloning (Takara), a ligase-free method to clone any insert into any vector ...
-
bioRxiv - Immunology 2023Quote: ... GISAID ID: EPI_ISL_408667) were amplified with polymerase chain reaction (PCR) using PrimeSTAR GXL DNA polymerase (Takara Bio Inc., Shiga, Japan). The corresponding SARS-CoV-2 genomic regions ...
-
bioRxiv - Developmental Biology 2023Quote: ... dsDNAs were amplified by PCR using modified primers with 5’Bioton – 5 x phosphorothioate bonds (synthesized by eurofins) and PrimeSTAR Max (Takara).
-
bioRxiv - Biochemistry 2022Quote: ... a DNA fragment encoding residues 1-132 was amplified using the RPA expression plasmid as a template and CloneAmp Hi-Fi PCR master mix (Clontech, Takara) following the manufacturer’s instructions ...
-
Docking Domain Engineering in a Modular Polyketide Synthase and its Impact on Structure and FunctionbioRxiv - Biochemistry 2023Quote: The DNA encoding VemG and VemH was amplified from the genomic DNA of Streptomyces venezuelae ATCC 10712 (DSMZ) by PCR and introduced into a pET22b(+) expression vector by In-Fusion Cloning (Takara). These expression plasmids were used as a template to generate all engineered venemycin assembly line constructs of this study via In-Fusion Cloning (Takara) ...
-
bioRxiv - Cell Biology 2023Quote: Primers designed to flank the MLR of human CDHR5 were used for PCR reactions with Human Small Intestine QUICK-Clone cDNA (Clontech) as the template ...