Labshake search
Citations for Takara Bio :
2351 - 2400 of 6736 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Cell Biology 2020Quote: ... at the C-terminus were amplified by PCR using KOD-Plus-Neo polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) for a template cDNA and then cloned into a pET-41 Ek/LIC vector (Novagen) ...
-
bioRxiv - Cell Biology 2020Quote: ... TTAGCTAGCCTTCTGATGTGATAGTTTATC TTCTG-3’ were used to amplify the 3xFLAG-BBS10 from the BBS10 ORF plasmid using CloneAmp HiFi PCR premix (Takara), which was further cloned into the CD520A-GFP plasmid via XbaI and Nhe I restriction sites ...
-
bioRxiv - Microbiology 2020Quote: ... DNA sequences that flanked the ittA sRNA locus were amplified using PCR with PrimeSTAR GXL polymerase (Takara, Mountain View, CA). For the upstream fragment ...
-
bioRxiv - Developmental Biology 2021Quote: The cDNAs for HA-tagged ELF3 were amplified from the KhES-1 cDNA library by PCR using PrimeSTAR GXL (Takara) and were subcloned into the pENTR/D entry vector (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... and first-strand cDNA was synthesized with 1 μg of total RNA using a SuperScript III First-Strand Synthesis System for RT-PCR (TaKaRa) following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: msPLCε cDNA was amplified by PCR from a mouse liver first-strand cDNA library (kindly gifted from Tomohiro Ishii) using Tks Gflex polymerase (TaKaRa) and was cloned between the NheI and KpnI sites of pECFP-N1 (Clontech ...
-
bioRxiv - Immunology 2022Quote: ... The following plasmids were generated by insertion of PCR-amplified fragments into the NotI-to-PmeI digested pEF-TAK-Flag using InFusion cloning (Clontech): pEF-TAK-Flag-UFL1 (GenBank ...
-
bioRxiv - Plant Biology 2022Quote: ... 1500 bp upstream sequence from +1 site of both AtNRAMP4 and AtPIC1 genes were amplified by PCR and subsequently cloned into the KpnI and SacI RE sites of the pAbAi vector (Takara). On the other hand ...
-
bioRxiv - Molecular Biology 2021Quote: ... UAS-dH1::GFP and UAS-dH1K27A::GFP stocks were prepared by inserting the corresponding ORFs (WT or carrying a K27A mutation generated by PCR) into pEGFP (Clontech) to generate fusion proteins and then the inserts were cloned into pUAST (details can be provided on request) ...
-
bioRxiv - Molecular Biology 2021Quote: Nested translocation PCR assays was performed from genomic DNA as previously described (29) using either LA Taq DNA polymerase (Takara) or Flex HS polymerase (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Molecular Biology 2021Quote: ... The first stranded cDNA was next amplified to produce double stranded cDNA in 20 amplification cycles by long distance PCR using the Advantage 2 polymerase mix (Takara, Clontech) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... Human CAD was PCR amplified from cDNA (Open Biosystems clone ID 5551082) using specific primers (Table S1) and ligated with In-Fusion (Clontech) into NotI linearized pcDNA3.1-GFP ...
-
bioRxiv - Genomics 2021Quote: ... Target regions were amplified by PCR using specific primer sets and high-fidelity PrimeSTAR GXL DNA polymerase (Takara, Shiga, Japan). Sanger sequencing was performed using BigDye Terminator reactions and loaded onto a 3730xl DNA analyzer (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Genes of target prokaryotic proteins were amplified by PCR from corresponding genomic DNA and inserted into the pEGFP-C1 vector (Clontech). Mutated genes of prokaryotic proteins were obtained by PCR site-specific mutagenesis ...
-
The Ets protein Pointed P1 represses Asense expression in type II neuroblasts by activating TaillessbioRxiv - Developmental Biology 2021Quote: ... Tll or PntP1 coding region was amplified using the CloneAmp HiFi PCR Premix (Catalog# 639298, Takara Bio., Mountain View, CA) from a cDNA library and cloned into pcDNA™3.1/His expression vectors (Catalog #V38520 ...
-
bioRxiv - Developmental Biology 2021Quote: All novel plasmids constructed for this study were based on the pSP Sox1/2/3> plasmid previously described (9) with the open reading frames replaced by PCR amplifications using a proofreading DNA polymerase (Primestar, Takara) and plasmids were assembled from linear PCR products using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative PCR was performed with the ABI PRISM Fast 7500 Real-Time PCR engine using the TB Green Premix Ex TaqII (TIi RNaseH Plus) (TaKaRa) and the miRcute Plus miRNA qPCR kit (SYBR Green ...
-
bioRxiv - Neuroscience 2021Quote: ... cytosol and/or nucleus content in each pipette were expelled into individual PCR tubes containing 11.5 µl of lysis buffer (Takara, 634984) and stored in −80 °C.
-
bioRxiv - Cell Biology 2021Quote: ... The vimentin-null mEFs expressing vimentin are created by PCR amplification of the vimentin coding sequence using CloneAmp polymerase (Clontech) from pcDNA4-vimentin (provided by J ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product was cloned into pET28a digested with restriction enzymes NotI and NdeI using InFusion HD Cloning (Takara Bio). Both cloning strategies introduce a hexahistidine tag followed by a thrombin cleavage sequence ...
-
bioRxiv - Biophysics 2021Quote: ... denatured at 85°C for 5 minutes and annealed at 47.5°C for 4 hours in a PCR machine (Takara-Bio). The folded DNA origami was then agarose-gel-purified (Douglas et al ...
-
bioRxiv - Cell Biology 2021Quote: ... dual sgRNA cassettes and plasmid DNA (pDNA) were PCR-amplified and barcoded with sequencing adaptors using ExTaq DNA Polymerase (Clontech) following the same procedure as Supplementary Note 1 in Najm et al ...
-
bioRxiv - Cell Biology 2021Quote: ... BicD and GFP CDS were amplified by PCR and the two fragments were combined into AttB-pUASp-K10 vector by InFusion cloning (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time qRT-PCR was performed as previously described using TB Green Premix Ex Taq II (Takara Bio Inc, Japan) and a QuantStudio 7 Real-Time PCR system (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: Cultured rat cortical neurons were infected with recombinant lentiviruses at DIV3 and harvested at DIV10 for qRT-PCR using SYBR green qPCR master mix (Takara). Total RNA was extracted from rat cortical neurons using the TRIzol reagent (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting PCR products were cloned into a NsilI/SphI digested pSW-lacZ::sfGFP backbone by infusion cloning (Takara, Z9633N).
-
bioRxiv - Neuroscience 2020Quote: Cultured rat cortical neurons were infected with recombinant lentiviruses at DIV4 and harvested at DIV11 for qRT-PCR using SYBR green qPCR master mix (TaKaRa). Total RNA was extracted from mouse cortical neurons using TRIzol reagent (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... and the resulting PCR product gel extracted and inserted into the XhoI/NheI-cut plasmid via In-Fusion Cloning (Takara) to make the donor vector pM2GT-1437000-mNeonGreen-3xHA ...
-
bioRxiv - Neuroscience 2020Quote: ... the 11kb genomic region encompassing kdm5 was amplified by PCR from w1118 and cloned into the pattB vector (Bischof et al., 2007) using the In-Fusion cloning system (Takara). A 3xHA tag was included in-frame at the 3’end of the kdm5 ORF ...
-
bioRxiv - Immunology 2021Quote: ... [50]) coding for Drosophila SPARC was used as a template for PCR amplification using Takara Ex Taq polymerase (Takara Biomedicals) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Two ∼0.5□kb DNA fragments flanking the genes of interest were amplified by PCR using PrimeSTAR GXL DNA polymerase (Takara bio), M ...
-
bioRxiv - Cell Biology 2020Quote: ... 3C protease-cleavage site and a His12-tag at the N-terminus were amplified by PCR using KOD-Plus-Neo polymerase (Toyobo) and Human Universal QUICK-Clone cDNA II (Clontech) as a template cDNA and then cloned into a pET-41 Ek/LIC vector (Novagen) ...
-
bioRxiv - Plant Biology 2021Quote: ... captured DNA fragments were PCR-amplified using Takara LA Taq DNA Polymerase over 15 cycles (Clontech/Takara Bio, Otsu, Japan) then purified using AMPure PB Beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... a DNA fragment of the TkR86C coding region was amplified from cDNA from the Canton-S wild type strain by PCR (PrimeSTAR GXL, TaKaRa Clontech) with primers that had NotI and XbaI sites at 5’ and 3’ ends ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR product and the pMECS phagemid vector were digested sequentially with Pst I and Not I (TaKaRa, Dalian, China) and then ligated by T4 DNA ligase at 16°C overnight ...
-
C53 interacting with UFM1-protein ligase 1 regulates microtubule nucleation in response to ER stressbioRxiv - Cell Biology 2020Quote: ... The complete sequence of CDK5RAP3 without the stop codon was excised from pCR-hCDK5RAP3 by NheI/SalI and ligated into pEGFP-N3 (Clontech), resulting in plasmid phCDK5RAP3-EGFP ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1µl diluted cDNA was used as the template for each reaction with Emerald Amp GT PCR Master Mix (Takara, RR310). After appropriate amplification cycles ...
-
bioRxiv - Molecular Biology 2022Quote: ... gDNA extracted and PCR genotyped with primers (Supplemental table 1) flanking each homologous arms using PrimeStar GXL DNA polymerase (Takara). Correctly targeted clones were further expanded and banked ...
-
bioRxiv - Biochemistry 2022Quote: ... and the linearized plasmid gel-extracted and assembled with PCR-amplified codon-optimized mNeongreen or mScarlet using In-fusion cloning (Takara). To generate pPD95.75-itr- 1p-mNG or pPD95.75-itr-1p-mSc plasmids pPD95.75-mNG plasmid was digested with HindIII and PstI ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative real-time RCR (qRT-PCR) was carried-out using SYBR Premix Ex Taq™ (Tli RNaseH Plus) (TaKaRa, Japan) and CFX96TM real-time PCR system (Biorad ...
-
bioRxiv - Microbiology 2022Quote: ... covering the full-length SARS-CoV- 2 genome were amplified by PCR using a PrimeSTAR GXL DNA polymerase (TaKaRa Bio), the synthesized cDNA and specific primer sets from CoV-2-G1-Fw to CoV-2-G10-Rv designed previously (21) ...
-
bioRxiv - Genetics 2022Quote: ... The protein-coding genomic sequence including 3 kbp promoter sequence was PCR-amplified and cloned into the pGreen0029 binary vector (Hellens et al., 2000) using In-Fusion Cloning system (Takara Bio Europe ...
-
bioRxiv - Microbiology 2022Quote: ... 16S rRNA gene sequences were amplified by polymerase chain reaction (PCR) using LA Taq polymerase (TaKaRa-Bio, Inc., Kusatsu, Japan) for Illumina MiSeq paired-end sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... cDNAs were diluted 1/10 and PCR reactions were conducted using SYBR qPCR Premix Ex Taq II Tli RNase H+ (TAKRR820W, Takara). Primers can be found in Supplementary Table 4 ...
-
bioRxiv - Cell Biology 2022Quote: ... The cDNA was amplified via PCR and cloned into the appropriate vector backbones (empty pCS2+ or pCS2+ with C-terminal 3xeGFP) using InFusion Assembly (Takara). The GAP-dead mutant (RGA-3/4R80E ...
-
bioRxiv - Cell Biology 2022Quote: pLVX-Puro GFP-TMEM11 was generated by PCR amplifying TMEM11 from human cDNA and cloning into the XhoI/BamHI sites of pAcGFP1-C1 (Takara), followed by subsequent cloning of the GFP-TMEM11 cassette into the Xho/BamHI sites of pLVX-Puro (Takara ...
-
bioRxiv - Plant Biology 2021Quote: ... The CDS of the NON-RIPENING gene (NOR, Solyc10g006880) was amplified from the synthesized cDNA by PCR using PrimeSTAR GXL DNA Polymerase (TaKaRa) and the primer set SlNOR-pPLV26-F/R (Supplementary Table S11) ...