Labshake search
Citations for Takara Bio :
2451 - 2500 of 2560 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... plasmid and cloned within exon 4 (between base 43-44) and exon 5 (between base 71-72) of the circ-HDGFRP3 sequence by In-Fusion Cloning Kit (Takara Bio) to obtain the final constructs p-circ-Ex4 and p-circ-Ex5.
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of a 1:5 cDNA dilution was used together with forward and reverse primers per each mRNA (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of cDNA was used together with specific forward and reverse primers for primary miR-43093 (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... The relative luciferase activity was determined by normalizing the firefly luciferase activity by the respective total EGFP protein amount quantified by Western blot using a GFP antibody (Clontech, 632460) in Image Studio ver 5.2 (LI-COR).
-
bioRxiv - Biophysics 2021Quote: ... The rTetR protein sequence was subcloned from the Tet-On transactivator used in the commercially available Tet-On 3G system (Takara Bio). FUSN was derived from Addgene #122148 and GBP was based on a previously described construct (Rothbauer et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK293T cells were transfected with a pMXs-puro vector carrying hXkr8-GFP or a pCX4-bsr vector carrying hBSG cDNA tagged with HA or FLAG together with pGP for the gag-pol fusion protein (Takara Bio), and pCMV-VSV-G-RSV-Rev (RIKEN) ...
-
bioRxiv - Neuroscience 2021Quote: Full-length human APP695 wild-type and mutant forms (APP:YFP, APPΔβ:YFP, APPGP:YFP) were inserted into pEYFP-N3 encoding the yellow fluorescent protein (YFP, Clontech, Mountain View, CA, U.S.). APPΔβ was generated by deletion of the juxtamembrane domain (aa 597-624 ...
-
bioRxiv - Plant Biology 2020Quote: ... All of the other genes encoding candidate RBOHD-associated proteins were cloned into epiGreenB5 by the same strategy using an In-Fusion HD Cloning Kit (Clontech, USA). To generate epiGreenB-pPB1CP::PB1CP-3-eGFP for transient expression in N ...
-
bioRxiv - Neuroscience 2020Quote: ... Nwd1 cDNAs corresponding to the N-terminal portion of the protein (accession number BC082552; 4bp–1026bp) were subcloned into pGBKT7 (Clontech Takara Bio) to express the N-terminal domain of Nwd1 fused with the GAL4 DNA-binding domain ...
-
bioRxiv - Systems Biology 2020Quote: ... proteins in whole cell extract and immunoprecipitated fractions were digested with 2 mg/mL proteinase K (Takara Bio Inc., Kusatsu, Japan) at 42°C for 2 h ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were transfected with plasmids expressing either SARS-COV-2 S protein WT or mutants (E1182K, L1193G, E1182K/L1193G, L1182K/L1186G/L1193G) by using Calcium phosphate transfection kit (Takara-Bio). 24 h post transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... genes were cloned into a His-SUMO fusion protein expression vector (Kim et al, 2018) using an In-Fusion Cloning Kit (639648, Takara Bio). The glycine-arginine-proline (GRP ...
-
bioRxiv - Immunology 2021Quote: ... and the NES sequence of the HIV-1 rev protein into pT2ADW vector (Komatsu et al., 2018) by In-Fusion cloning (Takara Bio).
-
bioRxiv - Plant Biology 2023Quote: ... His8-tagged soluble or insoluble CML recombinant proteins were purified at room temperature using Ni-NTA resin (His60, Takara Bio Inc.) using the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... HeLa cells were co-transfected to express each of EGFP-fused MK-D1 proteins with an endoplasmic reticulum (ER) localizing mCherry construct using the Xfect transfection reagent (Takara Bio). At 24 h post-transfection ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... adhaerens Mint PDZ-1/PDZ-2/P1BM protein sequences (as described in the results section) were cloned into the mammalian bicistronic expression vector pIRES2-DsRed2 (Clontech, USA) to express recombinant proteins bearing C-terminal myc epitope tags (Figure 6K) ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant His-tagged protein was purified from cell-free extracts using immobilized metal affinity chromatography (IMAC using Talon resin; Takara Bio). The buffer used during the purification process was 20 mM Tris-HCl ...
-
bioRxiv - Plant Biology 2023Quote: The gene encoding the PP1c1-293 protein (herein simply referred to as PP1c) was cloned into the pOPIN-SC3 vector (OPPF) via In-Fusion Cloning (Takara Bio), which provides a cleavable N-terminal 6xHIS-SUMO tag for purification and solubility ...
-
bioRxiv - Immunology 2023Quote: ... domain followed by an Avi-Tag(76) and a hexahistidine tag was cloned into a mammalian protein expression vector (pADD2) by In-Fusion (Takara Bio).
-
bioRxiv - Microbiology 2020Quote: ... 250 ng of RNA isolated from each condition was converted into cDNA and processed through the SMARTer® 5’/3’ RACE Kit (Takara Bio) for 5’-RACE following manufacturer protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Pdum-Lox2 and Avi-Post2 the SMART™ (Switching Mechanism At 5’ end of the RNA Transcript) RACE method (SMART™ RACE cDNA amplification kit, Clontech) was used (Brena et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... templates were constructed by cloning the 2 kb 5’ and 3’ homology arms into pPD95.77 plasmids using In-Fusion Advantage PCR cloning kit (Clontech, cat. no. 639621). We used the CRISPR design tool (http://crispr.mit.edu ...
-
bioRxiv - Immunology 2021Quote: TCR cDNA libraries for high-throughput sequencing were prepared by 5’rapid amplification of cDNA ends (RACE) using the SMARTScribe™ Reverse Transcriptase (Clontech, USA) as previously described (39 ...
-
bioRxiv - Genomics 2019Quote: The first-strand cDNA was synthetised from 1 μg of 5 tissues (root, stem, leaf, flower and peel) total RNA using Prime Script RT Reagent Kit (Takara, Dalian, China). The qRT-PCR reactions were performedin 96-well plates using the ABI 7500 fast Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2019Quote: ... Doxycycline-inducible NEK9 stable U2OS cell lines were generated through lentiviral transduction of parental U2OS cells stably carrying the pVLX-Tet-On-Advance vector (Clontech, PT3990-5). Briefly ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... We froze 5 μL of the supernatant in 45 μL of Tris-EDTA buffer (10 mM Tris, 1 mM EDTA, Takara Bio Inc.) before analysis by polymerase chain reaction (PCR) ...
-
bioRxiv - Biochemistry 2020Quote: Complementary DNA (cDNA) was generated from previously extracted total RNA (900 ng) using the SMARTER RACE 5’/3’ kit (Takara Bio USA) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... RNC 82-aa C34A with [SG]5 or [SG]10 repeats were constructed by the Prime STAR MAX (Takara Bio Inc., Japan) method using appropriate primers (Table 1).
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Cell Biology 2021Quote: 5’ and 3’ RACE reactions were performed to isolate full-length lncEry from the total RNA of MEP cells using the 5’- and 3’-Full RACE Kits (TaKaRa, Dalian, China) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Zoology 2019Quote: ... the cDNA ends of both genes were obtained via 5’- and 3’-RACE using the SMARTer™ RACE cDNA amplification kit (Clontech, USA). Resulting PCR products were directly sequenced and full-length cDNAs of the putative mudskipper desaturase and elongase were constructed by aligning overlapped regions of the cDNA fragments.
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 40 μL nematode liquid was transferred to a 1.5-mL Eppendorf tube with 40 μL of nematode lysis solution (Zhang et al., 2017) and 5 μL of protease K (Takara, Dalian, China). The mixture was then subjected to centrifugation at 2,000 ×g for 1 min before heating for 45 min at 65 °C in a constant temperature water bath ...
-
bioRxiv - Cell Biology 2021Quote: ... 5-AAC TTC GCG CTT CCT AAG TCC CCG AAG GA-3 using Prime STAR mutagenesis kit (Takara Bio Inc. Shiga, Japan). GFP-Rab27a was purchased from RikenBRC(Tsukuba ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Developmental Biology 2019Quote: ... 3×Flag-Adnp or HA-Ctnnb1 were subcloned into pTRE3G or pLVX-tight-puro expression vector (Clontech, PT5167-1 and PT3996-5) using In-fusion HD cloning system (Clontech ...
-
bioRxiv - Genetics 2020Quote: ... The 5’ and 3’ end of the viral genome was amplified by rapid amplification of cDNA ends by using the 5’ and 3’ Smarter RACE kit (TaKaRa, Dalian, China).
-
bioRxiv - Molecular Biology 2019Quote: The 5’ flanking sequence of the insertion sequence was obtained by the Genome Walking Kit according to the manufacturer instructions (TaKaRa, Dalian, China). The random primers were provided by the Genome Walking Kit and the specific primers designed based on theoretical insertion sequences (first round zsp1 ...
-
bioRxiv - Genetics 2020Quote: 5’ leader repeat lines were generated by cloning the same 28 repeat sequence described above with approximately 30nt on either side of intronic sequence into the 5’UTR of pEGFP-N1 (Takara Bio USA) in the 0+ reading frame ...
-
bioRxiv - Plant Biology 2022Quote: ... Cytosolic domain fragments of NbPMA3 (F1, F2 or F3) were fused with the Gal4 activation domain in pGADT7 (Clontech, PT3249-5, USA) and inserted into the Y187 strain under selection with SD/-Leu ...
-
bioRxiv - Immunology 2022Quote: Extracted RNA was thawed on ice and converted to first strand complementary DNA (cDNA) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA), as described by the manufacturer and a custom oligonucleotide that contained the template switch oligo and a unique molecular identifier (5’ TSO-UMI ...
-
bioRxiv - Plant Biology 2022Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB93 using Taq polymerase (Takara Bio Inc. Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... was amplified by PCR and inserted into the Cre-dependent AAV hSyn FLEx vector using BamHI/KpnI restriction sites.pTet-on (transactivator) was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmid pmCherry was generated by fusing the lacI-Ptrc inducible system and mCherry into the vector pBBR1MCS-5 using In-Fusion® Snap Assembly Master Mix (Takara Bio). All plasmids were extracted using QIAprep® Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Plant Biology 2023Quote: ... One base of 5’ dA overhang was added to the PCR amplicon of pMYB50 using Taq polymerase (Takara Bio Inc., Shiga, Japan), which was then cloned into pENTR5’-TOPO (Thermo Fischer Scientific ...
-
bioRxiv - Microbiology 2019Quote: Genes encoding tail and baseplate proteins (ORF95–ORF102) in spontaneous mutant phages were amplified by plaque PCR using DirectAmpPCR (TAKARA, Shiga, Japan) and analyzed by Sanger sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... Cell lysates were prepared using a French press and susequent protein purification accomplished using Talon metal affinity resin (TaKaRa Bio USA, Inc.) as described by the manufacturer ...
-
bioRxiv - Neuroscience 2020Quote: ... Nwd1 cDNAs corresponding to the N-terminal portion of the protein (accession number BC082552; 4bp–1026bp) were subcloned into pGBKT7 (Clontech Takara Bio) to express the N-terminal domain of Nwd1 fused with the GAL4 DNA-binding domain ...
-
bioRxiv - Plant Biology 2021Quote: ... Recombinant proteins were induced by 1 mM IPTG at 16°C for 20 h, then purified by a GST-tag Protein Purification Kit (Beyotime, Shanghai, China) or His TALON Purification Kit (Takara, Beijing, China). Corresponding primers are listed in Supplemental Table S2.