Labshake search
Citations for Takara Bio :
2151 - 2200 of 2560 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and deposited into a PCR tube with 5 μL lysis buffer (Takara Bio, San Francisco, CA). cDNAs were then prepared by reverse transcriptase (Takara Bio ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Molecular Biology 2023Quote: ... The solution was treated with 5 μg/mL RNaseA and 70 unit/ml DNase I (Takara) for 1 h at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... The obtained cDNA was subjected to 5’ RACE-PCR using SeqAmp DNA Polymerase (Takara Bio USA). Primers used for 5’ RACE-PCR and the number of PCR cycles are shown in Supplemental Table 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... the supernatant was loaded onto a 5 ml column of TALON® Metal Affinity Resin (TAKARA) equilibrated with Buffer A ...
-
bioRxiv - Cancer Biology 2020Quote: ... and TRIM27 cDNA was obtained in pENTR221 vectors from the UT Southwestern (UTSW) McDermott Center for Human Genetics and subcloned into pCMV-HA or pCMV-myc (Clontech, Mountain View, CA) between SalI and NotI restriction sites ...
-
bioRxiv - Systems Biology 2019Quote: ... PCR amplification allowed to obtain the coding sequence for human HSF1 that was cloned into peGFP N3 vector (Clontech Laboratories Mountain View, CA); the plasmid was then verified by sequencing (GATC Biotech ...
-
bioRxiv - Neuroscience 2021Quote: ... under control of the modified human GFAP promoter, GfaABC1D (Lee et al., 2008) using restriction cloning and In-Fusion HD assembly (Clontech, Takara Bio, USA). The following sequence elements were obtained from Addgene ...
-
bioRxiv - Biochemistry 2021Quote: A cDNA fragment encoding full-length human EGFR (UniProt accession no. P00533) was cloned into the pEGFP-N1 plasmid (Clontech, Mountain View, CA). To facilitate affinity purification ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1.25Lμg pVSV-G (second-generation lentivirus packaging system) into human embryonic kidney packaging cells GP2-293 (Clontech, Inc., Mountain View, CA, USA), using CalPhos™ Mammalian Transfection Kit (Clontech ...
-
bioRxiv - Neuroscience 2022Quote: Human embryonic stem cell (hESC)-derived cerebral organoids (hCOs) were generated from a commercially available hESC stem cell line (Takara Bio, Osaka, Japan), using the STEMdiff cerebral organoid kit (STEMCELL Technologies ...
-
bioRxiv - Plant Biology 2020Quote: ... The E.coli-expressed tNPR1-His protein was extracted and purified using TALON Metal Affinity Resin (Clontech). For rabbit immunization ...
-
bioRxiv - Plant Biology 2021Quote: ... and the GFP fusion proteins were detected using the JL-8 (Clontech, 632380; 1:2500 dilution) as the primary antibody and an HRP-conjugated Affinipure Goat Anti-Mouse antibody (Proteintech ...
-
bioRxiv - Plant Biology 2022Quote: ... protein solution was collected and subjected to purification using His60 Ni Superflow resin (TaKaRa, California, USA) to remove 6×His-SUMO tag from the protein preparations ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The recombinant Irg1-like protein was enriched using cobalt TALON Metal Affinity Resin (Takara Bio #635501) with gentle shaking for 1 hour at 4 ℃ and washed twice by centrifugation for 3 minutes at 3500 rpm at 4 ℃ and resuspension in the washing buffer (20 mM Tris pH 8.0 ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant protein was produced in Escherichia coli BL21 (DE3) and purified with TALON resin (Clontech). For immunization ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatants containing soluble target proteins were loaded into a Talon metal affinity resin (Clontech, USA). After washing three times with buffer A ...
-
bioRxiv - Cell Biology 2023Quote: ... The fluorescent proteins were probed with anti-GFP monoclonal (JL8, 1:2,000 dilution; TaKaRa Bio Inc.) and anti-RFP polyclonal (PM005 ...
-
bioRxiv - Molecular Biology 2022Quote: Cas9 and PFR2 protein was detected on western blots using the Guide-it Cas9 (Takara, 632607) and L8C4 (50 ...
-
bioRxiv - Molecular Biology 2023Quote: Protein interactions in vivo in yeast were assayed using the ‘Matchmaker Gold Two-hybrid System’ (Clontech) using the protocols provided by the supplier ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... Scaffolding protein was purified on a TALON Superflow metal affinity column (Takara Bio, San Jose, CA). Fractions containing scaffolding protein were pooled and concentrated in 12-14kDa MWCO dialysis tubing (Spectrum Chemical ...
-
bioRxiv - Synthetic Biology 2023Quote: ... protein-coding sequences for Tluc were replaced with corresponding fragments through In-Fusion cloning (Takara; 638948) or restriction cloning strategies ...
-
bioRxiv - Biophysics 2024Quote: Purified proteins or the artificial motor-cargo complex were diluted using 1× PBS (Takara Bio, T900) and loaded into custom-made microneedles prepared with the P1000IVF micropipette puller (Sutter Instrument) ...
-
bioRxiv - Microbiology 2024Quote: ... His-tagged PE11 recombinant protein was purified using Ni-NTA metal affinity resin (Clontech Laboratories, USA) in denaturing conditions using 8 M urea (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Microbiology 2019Quote: ... We added 5 μl of transformants (107/mL) on SD/–Leu/–Trp (Clontech, Mountain View, CA, USA) and SD/–Ade/– His/–Leu/–Trp (3 mM 3-AT ...
-
bioRxiv - Evolutionary Biology 2019Quote: Templates for mRNA in situ hybridization probes were cloned by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA or genomic DNA (see Supplemental File 1 for details) ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 5 ng of total RNA using the PrimeScript Reverse Transcriptase (Takara by Clontech) and a mix of random hexamers - oligo dT primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized from 5 ng of total RNA using the PrimeScript Reverse Transcriptase (Takara by Clontech) and a mix of random hexamers - oligo dT primer ...
-
bioRxiv - Developmental Biology 2022Quote: ... PGCs and EGCs were lysed at room temperature for 5 minutes in lysis buffer (Takara Bio, #635013) containing RNAse inhibitors (Takara Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Bioengineering 2020Quote: The cleared lysate was poured on 5 mL packed Ni-NTA agarose (His60 Superflow, TaKaRa Bio Europe) gravity flow columns ...
-
bioRxiv - Pathology 2020Quote: ... and 5 units of SMART Moloney murine leukemia virus reverse transcriptase (Takara Bio, Mountain View, CA, USA). The RT reaction was carried out at 42°C for 2 hrs ...
-
bioRxiv - Immunology 2021Quote: ... wild-type SARS-CoV-2 RBD was purified using a 5 mL HisTALON superflow cartridge (Takara Bio) followed by size exclusion chromatography using a Superdex 200 10/300 GL column pre-equilibrated in 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 ng of total RNA (with a SMARTer Stranded Total RNA-Seq Kit v3; Takara Bio) was used.
-
bioRxiv - Molecular Biology 2023Quote: ... For quantitative RT-PCR 1ug of total RNA was treated with 5 Units of DNase I (Takara) and cDNA synthesized with SuperScriptIII (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... We next cloned the synthesized DNA into the pDON-5 Neo-vector (TaKaRa, Kusatsu, Japan, Cat# 3657), which was pre-linearized with NotI-HF (New England Biolabs [NEB] ...
-
Comprehensive mutational analysis of the checkpoint signaling function of Rpa1/Ssb1 in fission yeastbioRxiv - Genetics 2023Quote: ... the supernatant was loaded onto a 5 ml column with prewashed Talon resin (Clontech Laboratories, Inc, CA). The column was washed three times with the low pH buffer (pH 6.3) ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Cancer Biology 2024Quote: ... RT-PCR was performed using diluted cDNA (1:5 in water) and PrimeStar DNA Polymerase (Takara, R010A) with primers and PCR conditions listed in Table 1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... while amplicons over 5 kb were produced using PrimeStar GXL polymerase (Takara Bio, San Jose, CA, #R050A) in a two-step amplification reaction ...