Labshake search
Citations for Takara Bio :
2101 - 2150 of 2560 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Protein bands were detected by Western blot using a commercial 6xHis monoclonal antibody (631212, Clontech) and a goat anti-mouse IgG (H + L)-HRP conjugate (1706516 ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant proteins of interest were bound to TALON metal affinity beads (Clontech, Mountain View, CA) and eluted with imidazole (gradient 10–200 mM ...
-
bioRxiv - Microbiology 2021Quote: ... protein expression was induced with 1 mM of isopropyl-β-D-thiogalactopyranoside (IPTG; Takara Bio) at the final concentration at 25°C ...
-
bioRxiv - Biophysics 2021Quote: ... The solubilized protein was incubated with 2 mL TALON cobalt metal-affinity resin (Takara Bio) for 1 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... The RNA-binding protein expressing vector was based on the shuttle vector pGADT7 (Clontech, USA) and constructed as described previously [25] ...
-
bioRxiv - Microbiology 2020Quote: ... to remove cellular debris and the protein was column-purified using anti-histidine resin (ClonTech). The resin was washed ten times with 10x column volumes of wash buffer mixed with an increasing proportion of tris buffer (20 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... the protein was affinity purified using TALON cobalt affinity resin (Clontech Laboratories, Mountain View, CA) followed by size exclusion chromatography on Superdex 200 10/30 GL size exclusion column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the protein concentration was measured by a bicinchoninic acid (BCA) assay kit (Takara Bio) using bovine serum albumin as the standard ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... His6-tagged protein in the supernatant was captured on Talon Sepharose beads (#635502, Clontech/Takara) and pre-equilibrated against Buffer1 (300 mM NaCl ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... His6-tagged protein in the supernatant was captured on Talon Sepharose beads (#635502, Clontech/Takara) and pre-equilibrated against Buffer1 (300 mM NaCl ...
-
bioRxiv - Evolutionary Biology 2022Quote: CDS sequence coding protein BmMETTL3(204-329) was cloned into the Pcold vector (TaKaRa, China). Primers were listed in Table S1 ...
-
bioRxiv - Plant Biology 2022Quote: ... Proteins were purified by immobilized-metal affinity chromatography using TALON® metal affinity resin (Clontech), where filtered supernatant (0.45 μm filter ...
-
bioRxiv - Molecular Biology 2022Quote: The respective sequences of the proteins were cloned into pGBKT7 and pGADT7 vectors from Clontech which harbor either the DNA binding domain or activation domain at the N-termini ...
-
bioRxiv - Biochemistry 2024Quote: The Upf1-HD-His6 wild-type protein was first purified on a TALONTM resin (Clontech) equilibrated with buffer A200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The proteins were then purified using TALON metal-affinity resin (Clontech, Mountain View, California, USA) previously added and washed in PBS according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... The fusion protein was affinity-purified using TALON Metal Affinity Resin (Takara Biosciences; Table S4) and eluted in buffer containing 25 mM HEPES ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified from Escherichia coli BL21 (DE3) with TALON Metal Affinity Resin (Takara), Pierce Glutathione Agarose (Thermo scientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein concentration was measured using a BCA assay kit (Takara Bio Inc., Kusatsu, Siga, Japan). Twenty micrograms (µg ...
-
bioRxiv - Biophysics 2023Quote: ... the protein was affinity purified using TALON cobalt affinity resin (Clontech Laboratories, Mountain View, CA) followed by size exclusion chromatography on Superdex 200 10/30 GL size exclusion column (GE Healthcare ...
-
bioRxiv - Bioengineering 2023Quote: ... Proteins were purified from the soluble cell lysate using His60 Ni Superflow Resin (Takara Bio) and concentration was measured using NanoDrop ...
-
bioRxiv - Biophysics 2024Quote: ... The protein was purified to homogeneity using a combination of TALON Metal Affinity Resin (Takara) and gel filtration chromatography ...
-
bioRxiv - Biochemistry 2023Quote: ... The secreted dystroglycan protein DAG128–749R311A/R312A was purified using His60 Ni IMAC resin (Takara) and subjected to anion exchange using DEAE resin ...
-
bioRxiv - Plant Biology 2024Quote: ... Purification of the His6-tagged protein was achieved by TALON® spin columns (Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: The various proteins were produced in Escherichia coli strain BL21(DE3)-pGro7/GroEL strain (TaKaRa). The sequences were enhanced by an N-terminal strep tag (WSHPQFEK ...
-
bioRxiv - Cell Biology 2020Quote: The yeast strain AH109 was co-transfected with bait vector full-length human SNX4 or Lamin cloned into pGBKT7 (Clontech, Oxford, UK) against a pray library of FL SNX-BARs ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA ligation of the linearised pOPINTTGneo vector and the human UGGT1insert was achieved by In-fusion™ligation-independent cloning (Takara Ltd.)
-
bioRxiv - Neuroscience 2021Quote: ... under control of the modified human GFAP promoter, GfaABC1D (Lee et al., 2008) using restriction cloning and In-Fusion HD assembly (Clontech, Takara Bio, USA). The following sequence elements were obtained from Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid pMSCV-GADD34-puro contains the human PPP1R15A (GADD34, NM_014330.5) gene subcloned into the NcoI/EcoRI sites of the retroviral vector pMSCV-puro (Clontech Laboratories, Mountain View, CA).
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated from RAW264.7 cells and ground cartilage from human tibial plateaus using TRIzol reagent (Takara Bio Inc., Shiga, Japan). For mRNA quantification ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer specificity and amplification efficiency for genes of interest were verified by performing reactions on a dilution series of human reference cDNA (Takara, cat# 636693). Gene expression relative to GAPDH and RPLP0 house-keeping genes was calculated in Microsoft Excel ...
-
bioRxiv - Cancer Biology 2021Quote: ... at a molar ratio of 2:1:1 and transfected into the Lenti-X™ 293T packaging cell line (632180, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) using Xfect™ Transfection Reagent (631317 ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a molar ratio of 2:1:1 and transfected into the Lenti-X™ 293T packaging cell line (632180, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) using Xfect™ Transfection Reagent (631317 ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the beta-globin (HBB) 5’-UTR using the In-Fusion® HD Cloning Kit (Takara). The subsequent mutations in the TCRA and TCRB 3’-UTRs were generated using these initial constructs ...
-
Relationship between True Digestibility of dietary Phosphorus and Gastrointestinal Bacteria of GoatsbioRxiv - Microbiology 2019Quote: ... Taq buffer 5 μL of 10×Ex (20 mmol/L Mg 2+;TaKaRa Inc., Dalian, China), template DNA 0.35 μg ...
-
bioRxiv - Immunology 2019Quote: ... 5’ RACE first-strand cDNA synthesis was conducted using the SMARTer RACE cDNA Amplification Kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 5 μg was used as template for cDNA synthesis using Smart MMLV reverse transcriptase (Clontech). All cloning PCRs were performed with an initial denaturation at 94 °C for 2.5 min ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 ml HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into Cytiva 1x HBS- N buffer or PBS.
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 Beta RBD was purified using a 5 mL HisTalon Superflow cartridge (Takara Bio) followed by buffer exchange into PBS using a HiPrep 26/10 desalting column (Cytiva).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 mL HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into 1x HBS-N buffer (Cytiva ...
-
bioRxiv - Cancer Biology 2020Quote: ... with 5 µg of pTetOne NTF2 (pDL66) and 100 ng of linear hygromycin marker (#631625, Clontech). After 4 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatants were applied to a chromatography column packed with 5 ml His60 superflow resin (Clontech) that had been equilibrated with buffer A (20 mM HEPES pH 7.5 ...
-
bioRxiv - Plant Biology 2020Quote: ... 5’ and 3’ RACE (rapid amplification of cDNA ends) were performed using the manufacturer’s instructions (Clontech).
-
bioRxiv - Immunology 2019Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA) using primers with specificity to IgM ...
-
bioRxiv - Molecular Biology 2019Quote: Complete cDNA was synthesized from 5 ng total RNA using the SmartScribe reverse transcriptase (Takara Bio) with a universally tailed poly-dT primer and a template switching oligo followed by amplification for 12 cycles with the Advantage 2 DNA Polymerase (Takara Bio) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Antisense probes were radiolabeled at their 5′ ends with [γ-32P] ATP by T4 polynucleotide (Takara) and purified using Performa Spin Columns (Edge BioSystems) ...
-
bioRxiv - Immunology 2021Quote: ... using the modified (Switching Mechanism At 5’ End of RNA Transcript) PCR cDNA synthesis protocol (Clontech) and oligonucleotides as described below (Table S3) ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Neuroscience 2023Quote: ... each pipette was filled with 3μl of pipette solution which consisted of 5% RNase inhibitor (Takara) in RNase-free PBS (Invitrogen ...