Labshake search
Citations for Takara Bio :
201 - 250 of 6347 citations for Rat Starch Binding Domain Containing Protein 1 STBD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... was excised and inserted in frame into a pcDNA3 vector containing fireflluciferase cDNA followed by a T2A sequence using the Infusion HD-eco dry kit (Clontech), as per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cloned into into modified pJet:attB:mCherry vector (Roberts et al., 2014) containing phiC31 attB site and mCherry reporter using In-Fusion HD Cloning Kit (TaKaRa/Clontech) according to the manufacture instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Probes for FLuc (500 bp) were generated using gel-purified PCR amplicons containing GFP sequence and a BcaBEST Labeling kit (Takara) and [α-32P]-dCTP (PerkinElmer) ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was synthesized with the PrimeScript 1st Strand kit with an additional primer mix containing random DTs (#RR047A and #6110A, Takara). cDNAs were amplified using specific Taqman probes ...
-
bioRxiv - Immunology 2023Quote: ... into 96-well plates containing 12.5μl CDS sorting buffer as described in the SMART-Seq® HT Kit protocol (Takara Bio). Full-length cDNA amplification of single cells was performed per the kit protocol (Takara Bio) ...
-
bioRxiv - Neuroscience 2019Quote: Rat HRI was cloned into the Tet on-off system from Clontech (Tet-On® 3G Bidirectional Inducible Expression System with ZsGreen1 ...
-
bioRxiv - Microbiology 2021Quote: ... protein expression was induced with 1 mM of isopropyl-β-D-thiogalactopyranoside (IPTG; Takara Bio) at the final concentration at 25°C ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2021Quote: ... Reverse transcription reactions containing 1 μg of total RNA were performed using PrimeScript™ (Takara, Otsu, Shiga, Japan). Individual cDNAs were amplified with THUNDERBIRD™ SYBR qPCR Mix (TOYOBO CO ...
-
bioRxiv - Molecular Biology 2020Quote: ... the plug was incubated in 160 μl of 1× M buffer containing 160 units of Nhe I (TaKaRa) for 7 hr at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.6 μl PCR mix was dispensed to each well containing the following: 1× SeqAmp PCR buffer (Takara Bio), 0.025 U μl−1 of SeqAmp polymerase (Takara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... single cells were sorted into individual wells of 8-well PCR strips containing lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara 634894) with RNase inhibitor (0.17 U/μl) ...
-
bioRxiv - Neuroscience 2020Quote: ... single cells were sorted into individual wells of 8-well PCR strips containing lysis buffer from the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara 634894) with RNase inhibitor (0.17 U/μl) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and cloned into into modified pJet:attB:mCherry vector (Roberts et al., 2014) containing phiC31 attB site and mCherry reporter using In-Fusion HD Cloning Kit (TaKaRa/Clontech) according to the manufacture instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... containing RNAase inhibitor (Takara Bio, 2313B) and incubated for 15min ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing RNAse inhibitors (Takara Bio, #2313) to release mRNAs into solution ...
-
bioRxiv - Cell Biology 2021Quote: ... containing doxycycline (2 mg/ml, Clontech). We kept the cells in this medium for 5 days ...
-
bioRxiv - Cell Biology 2020Quote: ... 35 mm wells of MIN6 cells were co-transfected with 2.5 µg of pX330 containing gRNAs and 1 µg of pEGFP-C2 (Clontech). After 48 h ...
-
bioRxiv - Microbiology 2020Quote: ... primary antibody was prepared in PBS containing 1% non-fat milk using anti-hexahistidine antibody (Takara Bio, catalog #631212) at a dilution of 1:3000 ...
-
bioRxiv - Microbiology 2020Quote: ... 1) were annealed to a complementary 20-nt primer containing a 5’-fluorescein label (5’FAM-GUCAUUCUCCUAAGAAGCUA-3’, Takara). To perform the primer extension assay ...
-
bioRxiv - Neuroscience 2023Quote: ... the solution was replaced with a 0.5% BSA and 0.2% Triton X/PBS solution (PBST) containing a 1:1,000 dilution of Rabbit anti-DsRed (Takara, #632496) or Chicken Polyclonal anti-GFP antibody (Abcam ...
-
bioRxiv - Plant Biology 2021Quote: ... and the GFP fusion proteins were detected using the JL-8 (Clontech, 632380; 1:2500 dilution) as the primary antibody and an HRP-conjugated Affinipure Goat Anti-Mouse antibody (Proteintech ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... The fluorescent proteins were probed with anti-GFP monoclonal (JL8, 1:2,000 dilution; TaKaRa Bio Inc.) and anti-RFP polyclonal (PM005 ...
-
bioRxiv - Microbiology 2020Quote: ... RNAs extracted from 100 µl of virus-containing supernatants or PBMCs were amplified by using a PrimeScript® RT reagent Kit (Perfect Real Time) (Takara Bio) and 5’RACE was performed by using a 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Plant Biology 2021Quote: ... A 1 μg aliquot of RNA was used for the synthesis of the cDNA first strand using a PrimeScriptTMRT reagent Kit containing gDNA eraser (TaKaRa, Shiga, Japan). The cDNA was used as the template and primers in TableS1 were used to PCR amplify the sequence ...
-
bioRxiv - Immunology 2021Quote: Retroviral SARS-CoV-2 Spike pseudovirus were generated in 293T cells by co-transfecting expression plasmids containing SARS-CoV-2 Spike and MLV gag/pol and luciferase vectors using Calphos transfection kit (Takara Bio, USA) as described [20] ...
-
bioRxiv - Molecular Biology 2022Quote: ... and amplified by PCR using a forward primer containing a T7 promoter sequence (Supplemental Table 10) with the Advantage HF 2 kit (Takara Bio 639124) and the following cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned into a modified pCaSpeR4 vector containing the αTub84B promoter (Marois et al., 2006) using In-Fusion cloning kit (Takara Bio, Japan). Forward primer sequence was 5’-CTAGAGGATCCCCGGGTACCATGGTGAGCAAGGGCGAG-3’ and reverse primer sequence was 5’-TCGAGGGGGGGCCCGGTACCTTAATTGTAAGTAATACTAGATCCAGGGTATAAAGTT GTTC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: The pCAG-MDM4 expression vector was established by cloning of MDM4 sequence into a pCAG vector47 containing a multiple cloning site (pCAG-MCS) using In-Fusion® Snap Assembly Starter Bundle kit (#638945; Takara Bio). A single restriction digest was performed on the pCAG-MCS vector using XhoI (Cat ...
-
bioRxiv - Molecular Biology 2024Quote: The full length BRD4 DNA fragment was amplified by PCR from pcDNA4-TO-HA-BRD4FL (Addgene plasmid #31351)61 incorporated into linearized FM5 lentiviral vectors containing standardized linkers (generously provided by David Sanders) using the In-Fusion HD cloning kit (Takara Bio, 638910). BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Cancer Biology 2021Quote: ... a WST-1 cell proliferation assay kit (MK400, Takara Bio) was used according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The upstream and downstream regions adjacent to the binding site were amplified using Advantage 2 polymerase (Takara Bio, Shiga, Japan) from 3T3-L1 genomic DNA and cloned into the HR110-PA-1 vector (System Biosciences) ...
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Neuroscience 2022Quote: ... Incubation with primary antibodies was performed in blocking buffer containing rabbit anti-DsRed (1:1000, 632496; Clonetech-Takara Bio, Japan) antibody at 4°C for 1–2 days ...
-
bioRxiv - Cancer Biology 2022Quote: Telomerase-mediated extension and subsequent amplification of TRAP products were conducted in 25-µL reactions containing 1 µL of cell lysate and 2 U of Titanium Taq DNA polymerase (Takara). The other kit components—TRAP reaction buffer ...
-
bioRxiv - Immunology 2023Quote: The medium from transfected HEK293T cells was replaced with Opti-MEM containing 1 μM of B/B Homodimeriser (AP20187; Clontech) and incubated for 30 min ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Tissues expressing mCherry-tagged Yellow protein (ymCherry) were stained with rabbit anti-dsRed (Clontech 632496, 1:1000) and rat anti-DN-Cadherin (DN-Ex #8 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Concentrated protein was bound to 0.5–1 mL of His60 nickel or HisTalon cobalt resin (Takara Bio) for 0.5–1 hr at 4°C while rotating in a 10-mL Pierce disposable column (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2019Quote: ... Proteins were transferred onto a PVDF membrane and blotted using 1:2000 a-GFP (Cat 632381, Clontech), 1:2000 a-actin (AS13 2640 ...
-
bioRxiv - Systems Biology 2022Quote: Following the transfer of samples into a 384-well plate containing RT-PCR buffer with 3’ SMART-Seq CDS Primer IIA (SMART-Seq® v4 PLUS Kit, TaKaRa, cat# R400753); the samples were immediately denatured at 72ºC for 3 min and chilled on ice for at least 2 min ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 100 ng/ml Doxycycline (Clontech #631311) and 0.1 μl RNAiMAX per pmol siRNA (Thermofisher Scientific #13778150 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR fragments containing pLib vector backbone (Clontech) and EF1A promoter ...
-
bioRxiv - Microbiology 2020Quote: ... Total protein was extracted from 2,000 midguts using the lysis buffer supplied in the Capturem IP & Co-IP kit (Takara, 635721). The extracted proteins were divided into two equal parts and used for immunoprecipitation (IP) ...
-
bioRxiv - Microbiology 2022Quote: ... and E484Q mutations of the SARS-CoV-2 spike protein were determined by qPCR using mutation detection kits purchased from Takara Bio (Shiga ...
-
bioRxiv - Cell Biology 2023Quote: ... crossed with WT BDF1 males at E0.5 and electroporated with RNP complex of Mavs targeting sgRNA (100 ng μL-1) and Cas9 protein (Takara Bio; 500 ng μL-1) using NEPA21 electroporator ...
-
bioRxiv - Genomics 2019Quote: ... 1-mM SMARTer Kit dNTP Mix (10 mM each; Clontech, 634936), 1.2-μM SMARTer Kit SMARTer II A Oligonucleotide (12 μM ...
-
bioRxiv - Biophysics 2021Quote: ... Constructs containing both His and Strep tags were purified using gravity flow columns containing His60 Ni-NTA resin (Clontech) followed by Streptactin affinity chromatography (IBA Lifesciences ...
-
bioRxiv - Genetics 2021Quote: ... was amplified from genomic DNA isolated from tail and peripheral blood using 1 µl of prepped DNA in 20 µl of PCR reaction containing 0.4 µl of PrimerStar GXL (TAKARA Bio, R050A), 4 µl of 5× Buffer ...
-
bioRxiv - Biochemistry 2020Quote: Inducible K562 cells were plated at 2.5×105 cells mL−1 in RPMI 1640 containing 0.25 μg/mL doxycycline (dox) (Takara Bio USA Inc.) in 10 cm plates and incubated at 95% humidity ...