Labshake search
Citations for Takara Bio :
1901 - 1950 of 2560 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: Doxycycline-inducible overexpression of transcription factors was achieved using the Lenti-X Tet-On 3G Inducible Expression System (Clontech; Cat. No. 631363) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... at P11 were transduced in a 6 well plate using 300 µl of Auto-hLAG3 LV pre-incubated with 30 µl of Lenti-X™ Accelerator (Clontech #631256) for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... After the immortalization procedure the absence of virus was verified using the Lenti-X p24 Rapid Titer Kit (Takara Bio USA, #632200).
-
bioRxiv - Immunology 2021Quote: ... viral stocks were concentrated by adding supernatant at a 3:1 ratio to Lenti-X Concentrator (631232, Takara Bio, Mountain View, CA). Mixtures were incubated overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Immunology 2020Quote: ... Viral particle counts were determined by sodium dodecyl sulfate disruption and spectrophotometry at 260 and 280 nm and viral titers were determined using the Adeno-X™ Rapid Titer Kit (Takara Bio). The constructs created included:
-
bioRxiv - Immunology 2020Quote: ... Lentivirus plasmids–encoding for BiTEs cDNA and 4th generation Lenti-X™ Packaging Single Shots (Takara Bio USA, Inc., Mountain View, CA) were used to produce lentiviral particles in HEK 293/17 cells ...
-
bioRxiv - Biochemistry 2022Quote: ... the RNAs of 150µl of the supernatant were extracted and quantified using Retro-X™ qRT-PCR Titration Kit (Takara, cat# 631453), according to the manufacturer instruction.
-
bioRxiv - Plant Biology 2022Quote: ... His (SD/-Trp/-Leu/-Ade/-His) and with sprayed 100 µl of 4 mg/ml X-α-Gal (Takara Bio, CA, USA) in dimethylformamide on plates (SD/-Trp/-Leu/-His/X-α-Gal) ...
-
bioRxiv - Cell Biology 2024Quote: ... HaloTag-mouse ACVR1B-HiBiT and HaloTag-mouse ACVR2B-HiBiT lentiviruses were generated in HEK293T cells using Lenti-X Packaging Single Shots (Takara Bio, 631276) and concentrated 20-fold with Lenti Concentrator (OriGene ...
-
bioRxiv - Developmental Biology 2024Quote: Lentiviral particles were produced following transient transfection of the shRNA-pLKO.1 vector and packaging plasmids into Lenti-X cells (632180; Takara Bio USA) using Attractene (301005 ...
-
bioRxiv - Cancer Biology 2023Quote: The MDM4 coding sequence (NM_002393.5) was cloned into Lenti-X™ Tet-One™ Inducible Expression System (Takara Bio, cat. no. 631847). The resulting plasmid was then subject to whole-plasmid sequencing for verification ...
-
bioRxiv - Plant Biology 2023Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal and supplemented with 0.2 µg/ml Aureobasidin A (Takara Bio, USA). Plates were imaged after incubation for 60–72 hr at 30 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Virus-containing supernatant was harvested at 48 and 72 hours after transfection and viral particles were concentrated with Lenti-X Concentrator according to the manufacturer’s instructions (Takara Bio cat#631232). Lenti-X GoStix Plus were then used to determine virus titer (Takara Bio cat#631280) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and transgene plasmids were transfected into HEK293FT cells to generate lentivirus media as previously described (33) and concentrated using Lenti-X concentrator (Takara Bio #631232) according to the manufacturers protocol.
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Microbiology 2020Quote: ... 0.125 µl of HotStart ExTaq (TaKaRa, 5 U/µl, 0.625 U/µl final), 1 µL reverse primer (10 µM concentration ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’RACE reaction was performed according to the kit manufacturer’s instructions (Clontech / Ozyme ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A total of 5 ml of Talon Metal Affinity Resin (Takara Bio USA) was added to the supernatant and mixed overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 MOI retrovirus and 5 µg/cm2 RetroNectin reagent (Takara, Cat. No. T100A) were used in the transduction following the manufactory protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μL of 2× SYBR Premix Ex Taq II (TaKaRa, Beijing, China), 1 μL of cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction system included 5 μL SYBR® Premix Ex TaqTM (Takara, China), 1 μL template ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl of 10X ExTaq buffer and 0.375 μl of ExTaq polymerase (Takara) and water to a final volume of 50 μl ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... The PCR mixture contains 5 ul EmeraldAmp GT PCR Master Mix (Takara, #RR310B), 1 ul genomic DNA ...
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was incubated with 5 ml of TALON resin (Takara Bio) for 90 min at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 U Takara Epi Taq HS (Takara, cat. no. R110A, 5 U/µl), 2.5 mM MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was loaded onto a 5-ml TALON metal affinity resin (Clontech) equilibrated in loading buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2024Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 800 ng RNA was used with the SMARTer RACE 5’/3’ kit (Takara) following manufacturer instructions ...
-
bioRxiv - Biophysics 2019Quote: ... the detergent-solubilised protein were batch bound to Co2+-charged Talon resin (Clontech) by gentle rotation at 4 °C for 1 h ...
-
bioRxiv - Systems Biology 2021Quote: ... the inducible fluorescent protein was induced by adding 1 μg/ml doxycycline (Clontech) alone or together with 100 nM rapamycin (Harveybio ...
-
bioRxiv - Neuroscience 2021Quote: ... the fluorescent proteins were amplified from pAM FLEX eGFP and pmCherry-C1 (Clontech) respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... 6xHis tagged proteins were purified using Talon Co2+ affinity resin (Takara Bio, USA) and eluted with 150 mM Imidazole in the lysis buffer pH 7.8 ...
-
bioRxiv - Microbiology 2021Quote: ... The protein bands were visualized using the Western BLoT Hyper HRP Substrate (TAKARA) and exposed using a Chemiluminescence Imaging System (Fusion Solo S ...
-
bioRxiv - Cell Biology 2022Quote: Every protein expressed in mouse rods was also cloned into pEGFP-N1 (Clontech) for expression in AD293 cells using the AgeI and NotI cloning sites within the vector to replace EGFP with the tagged proteins ...
-
bioRxiv - Plant Biology 2020Quote: ... Transferred proteins were first probed with anti-GFP (Takara Bio, 1:5,000 dilution) for 16 h ...
-
bioRxiv - Biochemistry 2021Quote: ... The recombinant proteins were purified with His60 Ni Gravity Column Purification Kit (Clontech) following a manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... the Rab8A proteins were co-expressed with the chaperone GroEL/S (pGro7, Takara). The expression of the GroEL/S chaperone was auto-induced by supplementing the LB-medium with 1 mg/mL arabinose.
-
bioRxiv - Biochemistry 2021Quote: ... Proteins in the supernatant were purified by the affinity chromatography with TALON (Clontech) resin ...
-
bioRxiv - Cell Biology 2020Quote: ... Shield-1 ligand for stabilization of DD-tagged proteins was purchased from Takara Bio (Cat # 632189 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monoclonal U-2OS cell lines stably expressing Tet-On 3G transactivator protein (Clontech), a tandem-dimeric MS2 hairpin binding protein tagged with eYFP (MS2CP-YFP) ...
-
bioRxiv - Plant Biology 2024Quote: ... The JMJ27-GFP fusion protein was detected using the anti-GFP (Takara: 632593) 1:2,000 (v ...
-
bioRxiv - Microbiology 2024Quote: ... The fusion protein was affinity-purified using TALON metal affinity resin (Takara Biosciences) and eluted in buffer containing 50 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... for GST-tagged protein or on TALON-Cobalt beads column (635507, Takara Bio) for 6XHIS-tagged protein as previously described [19,26] ...