Labshake search
Citations for Takara Bio :
1751 - 1800 of 2499 citations for PCR Strips since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... using KOD One PCR Master Mix (TOYOBO) was subcloned into the AgeI- and NotI-digested EGFP-N1 vector (Clontech), and subsequently full-length EGFR fragment was subcloned into the NheI- and HindIII-digested the LgBiT-inserted EGFP-N1 vector ...
-
bioRxiv - Genomics 2022Quote: ... prior to another round of PCR amplification for 16-18 cycles using either LA-Taq or PrimeSTAR GXL (Takara) at an annealing temperature of 60℃.
-
bioRxiv - Evolutionary Biology 2022Quote: ... and then was transcribed to cDNA using the Clontech SMARTer PCR cDNA Synthesis Kit (Clontech, Mountain View, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Human PDE4D5 wild type and PDE4D5-dN mutant were PCR amplified and cloned into pLVX-mCherry-N1 vector (Clontech) using Gibson assembly after vector digestion with XhoI and EcoRI ...
-
bioRxiv - Cell Biology 2019Quote: ... Each sub-cloning was done by using the In-Fusion PCR cloning kit (Clontech Laboratories, Mountain View, CA, USA). Plasmids were integrated at the lys1 gene locus ...
-
bioRxiv - Molecular Biology 2019Quote: ... Full length cDNA synthesis was done from polyA RNA using Clontech SMARTer PCR cDNA synthesis kit (Clontech Laboratories; (23)) ...
-
bioRxiv - Molecular Biology 2019Quote: Each polymerase chain reaction (PCR) was carried out in 50-µL volumes containing 2U Taq DNA polymerase (Takara Co.), approximately 20 ng template DNA ...
-
bioRxiv - Biochemistry 2019Quote: ... Both PCR-amplified sequences were cloned into a pLVX-Puro vector (Clonetech) using Gibson assembly (In-Fusion cloning, Takara), to form GCP2_G5A_TEV_G5A_mTagBFP_G5A_BAP ...
-
bioRxiv - Cell Biology 2020Quote: EGFP-Rab5 construct was generated by PCR amplifying human Rab5a from cDNA and subcloning into the pEGFP-C2 (Clontech) vector using XhoI/BamHI restriction sites ...
-
bioRxiv - Neuroscience 2020Quote: ... The mRNA expression was quantified using the SYBR green PCR kit (TaKaRa SYBRR Premix Ex Taq. II, Dalian, China) in a CFX96 Touch apparatus (Bio-Rad ...
-
bioRxiv - Developmental Biology 2019Quote: ... The rearranged region between the promoter and GOIs (500-600 bp) was amplified using CloneAmp HiFi PCR premix (Clontech) followed by Sanger sequencing (Genewiz ...
-
bioRxiv - Cancer Biology 2019Quote: ... Real-time quantification PCR was performed using the SYBR Premix Ex Taq II (Tli RNase H Plus) (Takara, Japan) with the following primers ...
-
bioRxiv - Plant Biology 2020Quote: ... the DNA fragment of the mutation site was amplified by PCR using Takara Ex Taq polymerase (Takara Bio, Japan) followed by the dye terminator cycle sequencing reaction with the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... The molar concentration of the library was determined by quantitative PCR (qPCR) using Library Quantification kit (Takara Bio Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PCR products were cloned into the transcription vector pTB-207 [88] using the In-Fusion HD Cloning kit (Clontech) as described previously [89] ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PCR products were cloned into the transcription vector pTB-207 (69) using the In-Fusion HD Cloning kit (Clontech) as described previously (70) ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-SERT was digested with HindIII and AfeI and the PCR product was inserted by InFusion Cloning (Takara Clontech) to generate pAAV-SERT His-GCaMP6s ...
-
bioRxiv - Microbiology 2021Quote: ... PCR amplified using VR47F/R and cloned into KpnI and HindIII cut pOPINRSF using In-Fusion cloning (Takara Bio), resulting in pVR01 ...
-
bioRxiv - Microbiology 2019Quote: ... Purified PCR fragments were inserted into the pHEX2 plasmid (53) using the In-Fusion HD Cloning Plus kit (Clontech). Expression of the transgenes was controlled by the SAG1 promoter and selection was provided by the presence of the HPT selectable marker (50) ...
-
bioRxiv - Immunology 2020Quote: ... 1 μg of RNA per sample was used for first-strand synthesis by SMARTer PCR cDNA Synthesis Kit (Clontech). For quantitative RT-PCR (qPCR) ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Immunology 2020Quote: ... The RT products were amplified by nested PCR following the PrimeSTAR® HS DNA Polymerase kit protocol (Takara, Japan), with primers for TCRα and TCRβ ...
-
bioRxiv - Bioengineering 2021Quote: Plasmids were constructed by standard molecular biology methods such as polymerase chain reaction (PCR) and In-fusion cloning (Clontech). Mutations for specific amino acids were generated by overlap-extension PCR ...
-
Guidelines for accurate genotyping of SARS-CoV-2 using amplicon-based sequencing of clinical samplesbioRxiv - Genomics 2020Quote: ... CDC-USA assay targeting gene N (IDT # 10006713) and One Step PrimeScript™ III RT-PCR Kit (TaKaRa #RR600A). Serial dilutions of reference material were prepared ranging from 1 to ~10M genome equivalents per reaction ...
-
bioRxiv - Evolutionary Biology 2020Quote: The water-in-oil droplets after the incubation step were diluted 10000-fold with 1 mM EDTA (pH 8.0) and subjected to RT-qPCR (PrimeScript One Step RT-PCR Kit (TaKaRa)) with primer 1 and 2 after heating at 95 °C for 5 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... They are routinely tested for contamination of mycoplasma by using PCR Micoplasma Test Kit (Takara Bio Inc., Shiga, Japan) and confirmed to be negative before performing experiments.
-
bioRxiv - Evolutionary Biology 2022Quote: ... The measurement was performed after diluting the droplets 100-fold with 1 mM EDTA (pH 8.0) and using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara).
-
RTEL-1 and DNA polymerase theta promote subtelomeric DNA synthesis and telomere fusion in C. elegansbioRxiv - Genetics 2022Quote: PCR for the ITS-DNA synthesis assay was carried out using ExTaq polymerase (Takara Bio cat# RR001A, Kasatsu, Japan). 35 cycles were executed with 64°C annealing temperature and 1 minute extension time ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNA was reverse transcribed and applied for PCR/qPCR analysis with PrimeScript™ reverse transcriptase (2680B, Takara, Japan). As an internal control for normalization ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μl of the reaction mixture was prepared with 5 μl of SapphireAmp Fast PCR Master Mix (Takara #RR350B), 1 μl of each of forward and reverse primers (final concentration 0.2 μM) ...
-
bioRxiv - Microbiology 2022Quote: Amplified spike sequence was first gel-purified using NucleoSpin Gel and PCR Clean-up kit (Takara, Cat. No. 740609.5) and then further purified using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2022Quote: ... Viral load was measured by RT-qPCR using One-Step SYBR® Primescript(tm) RT-PCR kit II (Takara). CT values from serum samples were used to calculate serum viral load according to regression equation built by a set of standard viral RNA extracted from dilutions of known titre virus preparation ...
-
bioRxiv - Plant Biology 2022Quote: ... aril and kernel tissues were pooled equally and cDNA was synthesized using the SMARTer PCR cDNA Synthesis Kit (Clontech). Size fractionation and selection (1-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... Gαi2 and Trpc2 cDNAs were amplified by PCR from female rat VNOs (PrimeSTAR® GXL DNA Polymerase Takara, Japan). Vom1r68 was synthesized by BGI (China) ...
-
bioRxiv - Plant Biology 2023Quote: ... Genomic DNA was used as template for PCR using TaKaRa Ex Taq or PrimeSTAR GXL DNA polymerase (Takara Bio), according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5xmyc-RPGRIP1L cDNA was amplified from the plasmid pCS2-5xmyc-RPGRIP1L (23) using CloneAmp HiFi PCR Premix (Takara # 639298) using primers ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative RT-PCR was used to determine gene expression using the SYBR Green Realtime Master Mix (Takara, DaLian, China). Table 1 contains a list of all primers used in this study ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplification from genomic and plasmid DNA templates was performed using PrimeStar Max DNA polymerase (Takara Bio, Kusatsu, Japan) or GoTaq Master Mix (Promega ...
-
bioRxiv - Microbiology 2024Quote: Quantitative PCR (qPCR) was conducted using a Thermal Cycler Dice Real Time System III (Takara Bio Inc., Shiga, Japan). For each 25 μL reaction ...
-
bioRxiv - Bioengineering 2024Quote: Primers oAS344 and oAS345 were then both used to amplify the cDNA using CloneAmp PCR Master Mix (Takara 639298) according to manufacturing protocol ...
-
bioRxiv - Immunology 2024Quote: ... and PVI.V-12 were amplified via PCR and cloned into the LALA and LALAPG IgG1 vectors using InFusion cloning (Takara).
-
bioRxiv - Neuroscience 2024Quote: ... Real-time PCR was performed using a Thermal Cycler Dice Real-Time System II TP900 (Takara Bio, Shiga, Japan), and the relative copy number of various gene transcripts per beta-actin transcript was determined using calibration standards for each tested molecule ...
-
bioRxiv - Molecular Biology 2024Quote: To generate APRF1pro:APRF1-mVENUS and TOPP4pro:TOPP4-3xFLAG the genomic region of both genes including a region of around 1.5 kb upstream their transcription start sites were amplified by PCR and cloned by the InFusion cloning (Takara) into the pCAMBIA1300 in frame with the coding sequences of mVENUS or the 3xFLAG peptide ...
-
bioRxiv - Plant Biology 2023Quote: ... T-DNA insertions were then analysed using specific primers (Table S1) in PCR reactions with Emerald Master Mix (Takara). PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR analysis was performed with Light Cycler-480®II (Loche) using TB-Green (Takara, RR420) following the supplier’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... and fluorescent signals from resulting PCR products were acquired using a Thermal Cycler Dice Real Time System III (Takara). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... Real time PCR was carried out in 20 µl reaction mixtures containing 1x TB Green Premix Ex Taq (Takara), 1x ROX reference dye (Takara) ...
-
bioRxiv - Cancer Biology 2023Quote: ... real-time PCR was performed using TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (Takara Bio RR420A). The signals were measured in the QuantStudio 3 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Genetics 2023Quote: ... The PCR fragments were purified and inserted into the vector pigAct88F-GFP [58] through recombinational cloning (In-Fusion, Takara). Primers used for the PCR reactions (sequences for recombination are underlined):
-
bioRxiv - Microbiology 2023Quote: ... High-throughput qPCR (HT-qPCR) was performed by the Smart Chip Real-time PCR system (Takara Bio USA, Inc.). A non-template negative control was set for each primer set ...