Labshake search
Citations for Takara Bio :
101 - 150 of 1155 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Specific forward and reverse primers (Suppl Table 3) were designed using the In-Fusion Cloning Primer Design Tool from TaKaRa (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was annealed to primers by the addition of 4 µL 100 µM Random Hexamer Primers (TaKaRa, Mountain View, CA) and incubation at 65°C for 5 min ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR reaction was prepared using gene-specific primers (20µM, Eurofins, primer sequences in Suppl. Table 4) and PrimeSTAR® Max DNA Polymerase (Takara) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... the commercial 10x universal primer mix (Takara USA) was used at a final 1x concentration ...
-
bioRxiv - Immunology 2021Quote: ... The commercial 10x universal primer mix (Takara USA) was used at a final 1x concentration ...
-
bioRxiv - Immunology 2022Quote: ... Primer/Probe N2 (2019-nCoV) (Takara, Cat# XD0008) were used as follows ...
-
bioRxiv - Microbiology 2020Quote: ... prepared using a random primer labeling kit (Takara)79.
-
bioRxiv - Microbiology 2023Quote: ... we used Primer/Probe N2 (2019-nCoV) (TaKaRa). The reaction conditions for RT-PCR were 42 °C for 5 min and 95 °C for 10 s ...
-
bioRxiv - Cell Biology 2023Quote: ... The primers for In-fusion cloning (Takara Bio) Fstl1 are (Forward 5’-CACAGACGCGTACCGGTGCCACCATGTGGAAACGATGGCTGGCGCTC-3’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a random primer DNA labeling kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... using oligo-dT primer (#3805, Takara, Shiga, Japan). A quantitative (q)PCR was performed on a Thermal Cycler Dice Real Time System (Takara ...
-
bioRxiv - Cell Biology 2024Quote: ... protocol with the P5 forward primer mix (Takara) and a unique reverse P7 primer for each condition ...
-
bioRxiv - Immunology 2021Quote: ... the copy number of WSSV was detected by qPCR analysis using Premix Ex Taq (Probe qPCR) (TaKaRa, Japan). The qPCR was performed with WSSV-specific-primers (5’-TTGGTTTCATGCCCGAGATT-3’ and 5’-CCTTGGTCAGCCCCTTGA-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... under high mutation rate conditions (9-16 mutations per kilobase pair) and subcloned into the pN1 vector (Clontech). Obtained gene libraries in expression vectors were electroporated into NEB10-β E.coli host cells (New England BioLabs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... qPCR was performed using Titanium Taq (Clontech) and SYBR Green on a Roche Lightcycler 480 (Roche Diagnostics ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR mix (Takara Bio Inc., Japan), with primers and probe specific for the SARS-CoV-2 E gene ...
-
Core Microbiota Drive the Prevalence of Extracellular Antibiotic Resistome in the Water CompartmentsbioRxiv - Microbiology 2022Quote: ... High throughput qPCR (HT-qPCR) was implemented on SmartChip PCR system including a Multisample Nanodispenser and a Cycler (Takara SmartChip™ ...
-
bioRxiv - Microbiology 2023Quote: ... High-throughput qPCR (HT-qPCR) was performed by the Smart Chip Real-time PCR system (Takara Bio USA, Inc.). A non-template negative control was set for each primer set ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of DNA fragments of interest was performed by real-time qPCR using TB Green Fast qPCR Mix (Takara) and Thermal Cycler Dice Real Time System II (Takara) ...
-
bioRxiv - Biochemistry 2021Quote: Nucleosomes with the 145 base-pair DNA (200 ng each) were mixed with 0.01 unit/μL micrococcal nuclease (MNase; Takara) and incubated at 37°C for 0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads are then subjected to three TE-TW washes and loaded into WTA PCR (100 μM Truseq PCR primer: IDT, CTACGACGCTCTTCCGATCT; 100 μM SMART PCR primer: IDT, AAGCAGTGGTATCAACGCAGAGT; Terra PCR mix: Takara Bio, 639284) with cycling conditions 98°C for 2min ...
-
bioRxiv - Molecular Biology 2021Quote: ... using a Random Primer DNA Labeling Kit (TaKaRa, 6045) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5µM ISPCR Primer and 7.5mM dNTP mix (Takara Bio). PCR amplification was performed in a thermal cycler (BIORAD C1000 Touch Thermal Cycler ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Random Primer (nonadeoxyribonucleotide mix: pd(N)9) (TaKaRa) from the total RNA of Ophiocordyceps sp ...
-
bioRxiv - Neuroscience 2021Quote: ... 1× Universal Primer Mix (first PCR, Clontech Laboratories, Inc.) or 1× Nested Universal Primer (secondary PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... A mitochondrial DNA monitoring primer set kit from Takara Bio [San Jose ...
-
bioRxiv - Cell Biology 2023Quote: ... The primers for Sfrp1 In-fusion cloning (Takara Bio) are (Forward 5’-CTAGTGATT TCGCCGCCACCATGGGCGTCGGGCGCAGCGCGCG-3’ ...
-
bioRxiv - Immunology 2024Quote: ... TCR-specific primers and SMARTScribe Reverse Transcriptase (Takara Inc). After purification with Agencourt AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2020Quote: ... RT-qPCR analyses were carried out with KAPA SYBR FAST qPCR kits using a Thermal Cycler Dice Real Time System (TaKaRa) according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2020Quote: ... The presence of bacterial DNA was detected and quantified via amplification of the 16S rRNA bacterial gene and the ribosomal mosquito gene S17 via qPCR using the SYBR qPCR Premix Ex Taq (Takara) in a Light Cycler 480 (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... All RT-qPCR reactions were carried out in triplicate using ThunderBird SYBR qPCR Mix (TOYOBO) and Thermal Cycler Dice Realtime System (TAKARA), and normalized to mRNA expression level of human ribosomal protein L13A ...
-
bioRxiv - Microbiology 2024Quote: ... Quantification of ChIPed DNA and cDNA was performed by real-time qPCR using the TB Green Fast qPCR Mix (Takara) and Thermal Cycler Dice Real Time System II (Takara) ...
-
bioRxiv - Plant Biology 2020Quote: ... qPCR was performed using SYBR Green Mix (TaKaRa) on the 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Physiology 2021Quote: ... qPCR was conducted using PrimeScriptTMRT Master Mix (TaKaRa) on ABI 7500 Fast to quantify mRNA of MyoD ...
-
bioRxiv - Molecular Biology 2022Quote: ... with SYBR Green qPCR Master Mix (TaKaRa Bio). Relative gene expression levels were determined via 2-ΔΔCt analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... and titrated by RT-qPCR Titration Kit (Clontech) as well as EGFP-positive cell counts ...
-
bioRxiv - Immunology 2020Quote: ... qPCR was performed with the SybrGreen kit (Takara) and specific primers (Table S3) ...
-
bioRxiv - Molecular Biology 2023Quote: ... qPCR was performed on a thermal cycler (TaKaRa) using TB Green Premix Ex TaqTM II (TaKaRa ...
-
bioRxiv - Microbiology 2023Quote: ... with TB Green Advantage qPCR premix (Takara Bio) and the following primers (5’ to 3’) ...
-
bioRxiv - Developmental Biology 2023Quote: ... qPCR was performed using SYBR Premix (Clontech #RR820W) using the below primer sequences ...
-
bioRxiv - Neuroscience 2023Quote: ... Viral titre was determined by qPCR (LentiX, Takara).
-
bioRxiv - Neuroscience 2023Quote: ... Insoluble material was removed by centrifugation and the supernatant containing the receptor was rotated with Talon resin (Takara) overnight ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Systems Biology 2022Quote: ... Optimized coding sequences were synthesized as gBlocks (Integrated DNA Technologies) carrying 16-base pair overhangs at the 5’ and 3’ ends to facilitate in-fusion cloning (Clontech) into pET expression vectors (EMD MIllipore).
-
bioRxiv - Microbiology 2020Quote: ... residues 1-188 and residues 189-291 of PipB were amplified from SL1344 genomic DNA with the following oligonucleotide pairs and ligated into pGAD424 (Clontech): pGAD-PipB-1F and pGAD-PipB-291R ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant or RNA were directly used for one-step RT-qPCR using PrimeDirect™ Probe RT-qPCR Mix (TaKaRa, Japan) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Real-time PCR was performed using THUNDERBIRD SYBR qPCR Mix (TOYOBO) or TB Green Premix ExTaqTM II FAST qPCR (Takara Bio) using the StepOne Plus instrument (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech, Franklin Lakes, NJ, USA) with enzymes XhoI and BamHI replacing the tubulin sequence ...
-
bioRxiv - Genomics 2020Quote: ... 5X Primer Mix (P5 and P7 primers) and Terra™ PCR Direct Polymerase Mix 0.05 U/ µl at reaction (Takara Bio USA, CA, USA) via a thermal protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... or 1× Nested Universal Primer (secondary PCR, Clontech Laboratories, Inc.) and gene-specific primers ...