Labshake search
Citations for Takara Bio :
1 - 50 of 1155 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: PDGF-IRES-Cre was generated by cloning human PDGF-B and Cre into pQXIX vector (Clontech) as previously described5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primer pairs were synthesized by TaKaRa and displayed in Table EV3.
-
bioRxiv - Genomics 2021Quote: ... primer pairs specific for each investigated enhancer were used for PCR amplification with the EpiTaq HS polymerase (TaKaRa). Finally ...
-
bioRxiv - Molecular Biology 2024Quote: The oligonucleotide library was amplified with a pair of primers using PrimeSTAR® Max DNA Polymerase (Takara Bio). The P8 and P3 phagemids were double-digested using NcoI-HF® (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... Then 50 nl of primer pair solution mixed with 1X SmartChip TB Green Gene Expression Master Mix (Takara Bio) were loaded onto the SmartChip ...
-
bioRxiv - Microbiology 2023Quote: ... using Psme1Sal1-F/Psme1BamHI-R primer pairs (Table S4) and cloned as a Sal1/BamH1 fragment into pEGFPC1 (Clontech). For production of GST- and His6-Myc-fusion proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... The Human Mitochondrial DNA Monitoring Primer Set (TaKaRa, Cat # 7246) was used to determine mitochondrial DNA (mtDNA ...
-
bioRxiv - Genetics 2020Quote: ... and complementary primer pairs (sequences available on request) was used to generate TMEM127 variants in the pEGFP-C2 (Clontech Laboratories) and pCMV6-XL5 (Origene ...
-
bioRxiv - Genetics 2020Quote: ... Three overlapping MTM1 cDNAs were amplified using three pairs of cDNA primers from Tosch et al(Tosch et al. 2010) using the PrimeSTAR GxL kit (Takara). Primers are F1/R1 (ATGGCTTCTGCATCAACTTC / TGGAATTCGATTTCGGGAC ...
-
bioRxiv - Molecular Biology 2022Quote: ... qRT-PCR was performed using first-strand cDNA and a primer pair designed for target genes using the SYBR Premix Ex Taq Perfect Real Time Kit Tli RNAaseH Plus (TAKARA) and Thermal Cycler Dice Real Time System (Model TP800 ...
-
bioRxiv - Microbiology 2024Quote: Each individual SARS-CoV-2 fragment was amplified from their respective plasmids using an exclusive pair of primers (Supplementary Table 2) and high-fidelity PrimeSTAR GXL DNA polymerase (Takara), followed by gel isolation with NucleoSpin Gel and PCR Clean-up (Macherey-Nagel ...
-
bioRxiv - Biochemistry 2023Quote: The gene encoding XccOpgD (GenBank: AAM43366.1) was amplified by PCR with the primer pair shown in Supplementary Table 1 using PrimeSTAR Max (Takara Bio) and a genomic DNA of X ...
-
bioRxiv - Molecular Biology 2021Quote: ... A pair of gene specific primers TaAFR-F and TaAFR-R (S1 Table) and Tks Gflex™ DNA Polymerase (TaKaRa, Japan) were used to amplify the full-length coding sequences CDS amplified with Tks Gflex™ DNA Polymerase (TaKaRa ...
-
bioRxiv - Microbiology 2021Quote: ... Then PCR application using specific primer pairs (Supplemental Table 2) designed for H7N9 virus and Takara One-step RT-PCR kit (Takara, China) segment by segment ...
-
bioRxiv - Immunology 2024Quote: ... Two-step PCR to amplify gag or pol region was performed with eight different primer pairs (Supplemental Table 1) and Ex-Taq (TaKaRa-Bio) as described previously (17) ...
-
bioRxiv - Plant Biology 2020Quote: ... was then used for RT-qPCR with the primers shown below with THUNDERBIRD® qPCR Mix (TOYOBO) on a Thermal Cycler Dice Real Time System (Takara Bio). Radish Glyceraldehyde 3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Microbiology 2020Quote: ... The erythromycin resistance gene was amplified from plasmid pMG36e using primer pair EmrF/EmrR and then connected with linearized pMD19-GmloxP using In-Fusion HD Enzyme (Takara, Daliang, China), generating the plasmid pMD19-EmrloxP ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2022Quote: ... (RT-qPCR) in the presence of SYBR Green (TaKaRa TB Green Primer Ex TaqII, #RR820Q) was carried out using a BioScript PCR kit (Bioline ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR in the presence of SYBR Green (TaKaRa TB Green Primer Ex TaqII, #RR820Q) was carried out according to the manufacturer’s instructions in a BioRAD CFX 384 Thermal Cycler (BioRAD ...
-
bioRxiv - Biochemistry 2023Quote: ... The endogenous pfrkip locus was targeted by cloning 20 nucleotide guide region (5’-ATAATTGGTGCCAAATTGAA-3’) with primer pair GRKIPV5F/ GRKIPV5R using In-Fusion (Clontech, Mountain View, CA) in pL6eGFP plasmid [53] generating pL6eGFPgV5 plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed using specific primers mixed with the TB Green Premix Ex Taq (Takara, Japan) in a 20 μl reaction system ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV was titrated using quantitative PCR (qPCR) with primers for the ITR sequence (TaKaRa Bio Inc).
-
bioRxiv - Microbiology 2023Quote: ... transcripts of the target genes were amplified with the corresponding primer pairs (S2 Table) and quantified with SuperReal PreMix Plus (SYBR Green) (Takara biomedical technology, Beijing, China), using the 18S rRNA was used as control ...
-
bioRxiv - Bioengineering 2022Quote: ... PDGF-aa (20 ng/ml; R&D) is also supplemented to RHB-A (Takara). This medium composition will be referred to as RHB-A complete ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was then performed using gene-specific primers (Table S1) and TB Green Premix Ex Taq (Takara). Levels of gene expression were normalized to that of 16S ribosomal RNA gene (OL4498 and OL4449 ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed using gene-specific primers (Table 2) and TB Green Premix Ex Taq (Takara). Levels of gene expression were normalized to that of 16S rRNA and expression was assessed for each biofilm and each timepoint relative to its planktonic counterpart using the 2−ΔΔCt method (43).
-
bioRxiv - Cell Biology 2021Quote: ... for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio) for the cells following manufacturer protocol.
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Microbiology 2021Quote: ... The parasite load in the livers and HepG2 cells was evaluated by Taqman-PCR with primers and probes for 18S rRNA and GAPDH following the manufacturer’s instructions of Premix Ex Taq™ (Probe qPCR) (TAKARA). For the SYBR quantitative PCR assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... and axis sites (YBP1, GRR1) (see qPCR Primer Table) using the TB Green Premix Ex Taq II (Tli RNAse H Plus, Takara).
-
bioRxiv - Microbiology 2024Quote: ... The expression profile of target genes was evaluated using specific primers by using TB green RT-qPCR master mix (Takara) in BioRad Real time PCR instrument or Applied Biosystem QuantStudio-5 system ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 2021: Escherichia coli DH5 alpha (Takara (Korea)) ...
-
bioRxiv - Cell Biology 2023Quote: ... Synthesized cDNA was subsequently mixed with qPCR primers and TB Green Premix Ex Taq (Tli RNase H Plus, RR420A, Takara Bio). Real-time PCR quantification was performed using Cobas z 480 analyzer (Roche Diagnostics GmBH) ...
-
bioRxiv - Cell Biology 2022Quote: ... For gene analysis the cDNA was amplified using gene specific primers by qPCR with Takara 2X SYBR Green Mix (Takara RR420A) and analyzed in real time PCR machine (7500 Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA samples were reverse transcribed using an RT Primer Mix (oligo dT) and PrimeScript RT Enzyme Mix for qPCR (TaKaRa, Japan) following the manufacturer's protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and quantified by RT‒qPCR using Primer/Probe N2 (NIHON GENE RESEARCH LABORATORIES, INC. Miyagi, Japan) and One Step PrimeScript™ III RT‒qPCR Mix (TaKaRa) with CFX96 (Bio-Rad ...
-
bioRxiv - Immunology 2024Quote: ... RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus) (Takara #RR82WR) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... primer design was done using primer design tool (Takara). For inducible expression of the gene ...
-
bioRxiv - Immunology 2021Quote: ... with the modification that Ecotropic Receptor Booster (Takara, #631471) was added to the cells as suggested by the manufacturer ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR for pluripotency and trilineage spontaneous differentiation was performed according to the instruction manual of the human ES cell Primer Array (Takara Clontech).
-
bioRxiv - Molecular Biology 2022Quote: ... Primers were designed using the primer design tool from Takara Bio (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools) ...
-
bioRxiv - Cancer Biology 2024Quote: ... U6 primers (TAKARA) were used to normalize miRNA expression via the 2-ΔΔCq method (ΔCq = Cqtarget − Cqrereference).
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR for pluripotency and trilineage spontaneous differentiation was performed according to the instruction manual of the human ES cell Primer Array (Takara Clontech).
-
bioRxiv - Biochemistry 2020Quote: ... PTGS2 (qPCR, Takara) and MDA (SIGMA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Random Primer Mix (Takara) and 200 U SMARTScribe Reverse Transcriptase (Takara) ...
-
bioRxiv - Genetics 2020Quote: ... qPCR was performed with the SYBR Fast qPCR Mix (Takara, RR430A) in the Applied Biosystems 7900 Real-Time PCR System ...
-
bioRxiv - Physiology 2021Quote: ... and quantitative primers (Perfect Real Time Primer, Takara, Shiga, Japan, Supplemental Table S1). The expression was normalized to GAPDH within each sample.