Labshake search
Citations for Takara Bio :
1451 - 1500 of 1553 citations for SUN domain containing protein 2 SUN2 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... for 1 h at 4 °C with rotation and then transferred to gravity columns (Talon® 2 ml Disposable Gravity Column, Clontech, #635606-CLI). The lysate was drained and the beads were washed five times with cold wash buffer (50 mM Tris ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Cell Biology 2022Quote: ... containing a Kozak sequence added right before the ATG (RefSeq NC_045512.2) were synthesized by Eurofins (Ebersberg, EU) and subcloned into the pIRES2 vector with eGFP in the second cassette (Takara Bio Europe, EU). Truncated Δ4 and Δ8 E proteins ...
-
bioRxiv - Genetics 2024Quote: ... PCR was conducted as described earlier (section: RNAi-mediated knockdown of Pmtra-2) but using the proofreading PrimeSTAR HS DNA Polymerase (Takara Bio, Shiga, Japan) and Ex Taq DNA Polymerase (Takara Bio ...
-
bioRxiv - Biochemistry 2024Quote: ... Sub-library specific primers were then used to amplify 1 ul of cDNA template for 24 cycles using Advantage 2 PCR Mix (Takara Bio, Cat. 639206). Finally ...
-
bioRxiv - Neuroscience 2023Quote: ... were transiently cotransfected with a 2:1 mixture of Nav1.7-expressing plasmid8 and a pIRES2-ZsGreen bicistronic plasmid (Takara Bio, San Jose, CA) expressing ZsGreen and mouse FHF2B proteins.10 The same pIRES2-ZsGreen plasmid without FHF2 coding sequence served as the control ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Molecular Biology 2023Quote: ... was performed by quantitative real-time polymerase chain reaction (PCR) using the AAVpro™ Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Microbiology 2024Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C in a vertical rotating mixer (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... a Tet responsive 2 promoter comprised of seven repeats of TRE binding sites and a minimal CMV promoter (based on that in Clontech’s pTRE2-hyg vector), a loxP site ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies were anti-PLP (N-terminus; 1:5000, Rogers, 2008) anti-GFP (JL8; 1:2000 – 5000; Clontech); anti-alpha-Tubulin (DM1A ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... They were then incubated with primary antibody (rabbit anti-DsRed, 1:100, Takara Bio Clontech, order nr. 632496) overnight at 4°C ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... They were then incubated with primary antibody (rabbit anti-DsRed, 1:100, Takara Bio Clontech, order nr. 632496) overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... a mouse monoclonal antibody for bovine osteocalcin (code no. M042, clone no. OCG2; Takara Bio Inc., Shiga, Japan), and goat polyclonal antibody for FBXW2 (Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated with primary antibody (anti-Th [mouse] 1:1500, Immunostar; anti-dsRed [rabbit] 1:1500, Clontech) overnight at RT shaking ...
-
bioRxiv - Neuroscience 2022Quote: ... or a rabbit anti-DsRed polyclonal antibody (1:1000, Cat # 632496, RRID:AB_10013483, Takara Bio U.S.A., Inc., CA, U.S.A.). In addition ...
-
bioRxiv - Cell Biology 2024Quote: ... the membranes were incubated with a 1:2000 dilution of an anti-GFP antibody (Clontech 632381, clone JL8) for detection of Clover protein ...
-
bioRxiv - Bioengineering 2024Quote: ... GFP was detected with a monoclonal mouse anti-GFP antibody (JL-8, Takara Bio USA, San Jose, CA) in Western blot analyses.
-
bioRxiv - Neuroscience 2023Quote: ... the following primary antibodies were used: rabbit anti-dsRed (1:1,000, Cat.# 632496, Clontech Laboratories, Mountain View, CA), chicken anti-GFP (1:10,000 ...
-
RNA-binding protein YBX1 promotes Type H vessels dependent bone formation in an m5C-dependent mannerbioRxiv - Molecular Biology 2023Quote: ... The paraffin sections were de-waxed and stained with primary antibody OCN (#M173, Takara Bio, Japan, 1:100), and counterstained with Harris Hematoxylin.
-
bioRxiv - Molecular Biology 2020Quote: A codon-optimized synthetic gene corresponding to the full length nucleocapsid protein (Thermo GeneArt, Regensburg, Germany) was cloned into a modified pET28a vector using the In-Fusion cloning kit (Takara Bio Saint-Germain-en-Laye, France). The resulting plasmid encoded for an N-terminal His6 tag followed by thrombin and tobacco etch virus cleavage sequences upstream of the full-length nucleocapsid protein sequence ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Microbiology 2021Quote: ... The knockout construct was developed through In-Fusion using the purified amplicons based on the manufacturer’s instructions with the insert to vector ratio of 2:1 (Takara Bio, Mountain View, CA, USA) and transformed into E ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Bioengineering 2024Quote: ... To synthesize cDNA, total RNA (8 µL, ca. 500 ng) was mixed with 2 µL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37°C for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... the ORF4 region was amplified by RT-PCR with specific primers (Supplementary Table S2) using PrimeScript One Step RT-PCR Kit Ver.2 (Takara Bio Inc., Kusatsu, Japan), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...
-
bioRxiv - Genomics 2020Quote: ... and Living Colors DsRed Polyclonal Antibody (rabbit anti-E2-Crimson, Clontech [now Takara Bio USA], Mountain View, CA, USA). Sections were washed and stained with the secondary antibodies Streptavidin:Alexa Fluor 488 (Biolegend ...
-
bioRxiv - Cell Biology 2022Quote: ... 5um sections from paraffin blocks were used for immunofluorescence staining with the following primary antibodies: tdTomato (dsRed Mouse: Takara Biosystems 632392 ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an incubation overnight at 4°C with antiDsRed rabbit polyclonal primary antibody (1:1000, 632496 Takara Bio) diluted in a triton buffer (0.3% Triton X-100 diluted in PBS-DEPC) ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an incubation overnight at 4°C with antiDsRed rabbit polyclonal primary antibody (1:1000, 632496 Takara Bio) diluted in a triton buffer (0.3% Triton X-100 diluted in PBS-DEPC) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were analyzed on bleach agarose gels (0.06% bleach, 1% (w/v) agarose) for visualization of the RNA and on WB (anti-His antibody, Clontech) for visualization of His6-tagged Nsp1.
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies for embryo staining were used at the following final dilutions: rabbit anti-DsRed (1:400, Clontech 632496), rat anti-tropomyosin (1:200 ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were produced by transient transfection of human epithelium kidney 293T Lenti-X cells (Clontech Laboratories, Mountain View, CA) using the JetPrime transfection kit (Polyplus Transfection Illkirch ...
-
bioRxiv - Neuroscience 2023Quote: ... The next primary antibodies were used at the specified concentrations: rabbit anti-Dsred Pab (Takara Bio Cat# 632496, RRID:AB_10013483) [1:500] ...
-
bioRxiv - Microbiology 2023Quote: ... and subsequently stained using a horseradish peroxidase (HRP)-conjugated monoclonal anti-StrepTag antibody (Iba) or mouse anti-6His (Clontech) monoclonal antibody combined with rabbit anti-mouse-HRP polyclonal antibodies (DAKO) ...
-
bioRxiv - Developmental Biology 2023Quote: ... They were then incubated O/N at 4°C with the corresponding primary antibody: anti-DsRed (1:500; Clontech), mouse anti-GFP ([1:100] ...
-
bioRxiv - Plant Biology 2024Quote: ... Immunoreactive signals were detected using an ECL detection system (GR Healthcare) with anti-GFP antibody (1:5,000; JL-8; Clontech), anti-actin antibody (1:2,000 ...
-
bioRxiv - Neuroscience 2024Quote: Fluorescent immunohistochemistry was performed on free-floating coronal sections from each animal using antibodies against zsGreen (1:1000, Clontech), STEM121 (1:500 ...
-
bioRxiv - Cancer Biology 2024Quote: ... sections were stained overnight in 4°C with primary antibodies: human cytoplasmic antigen (1:1000, clone STEM121, Takara, Y40410), OLIG2 (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... The PCR-amplified promoter fragments were inserted into the XhoI-AgeI site of the pAAV using Ligation high Ver.2 (LGK-201; Toyobo: hGFAP(ABC1D) or In-Fusion HD Cloning Kit (Takara Bio, Shiga, Japan: mMBP promoter).
-
bioRxiv - Systems Biology 2022Quote: ... The blocked membrane was incubated overnight at 4 ℃ in primary antibodies: mouse polyclonal anti-Cas9 (Takara Bio, cat. no. 632607), mouse monoclonal anti-β-actin (8H10D10 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% normal donkey serum) for 1h at room temperature followed by incubation in primary antibodies (rabbit anti Ds-red, Takara, cat# 632496 ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with antibodies against GFP (anti-GFP.1, 4°C overnight, Takara Bio Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with antibodies against GFP (anti-GFP.1, 4°C overnight, Takara Bio Clontech, 632381 or anti-GFP.2 ...