Labshake search
Citations for Takara Bio :
51 - 100 of 1168 citations for Mouse ADAMTS16 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... 53) and Hif1β shRNA (target sequence: 5’-GGACAGAGATCCAAGGTTT-3’) were cloned into the pSIREN-RetroQ expression vector (631526; Clontech Laboratories Inc., Mountain View, CA). The FLAG-tagged mouse Pdx1 coding sequence was amplified by PCR and subcloned into a pMXs-Neo Retroviral vector (RTV-011 ...
-
bioRxiv - Biochemistry 2022Quote: ... Both pFCDUET-YopH phosphatase and pGKJE8-GroEl/GroEs chaperones plasmids (Takara chaperone plasmid set cat. # 3340) were used for co-expression experiments ...
-
bioRxiv - Plant Biology 2022Quote: ... prey plasmids from library were rescued from yeast clones with “Easy Yeast Plasmid Isolation Kit” (Clontech) and sequenced ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting plasmids were used to generate the R mutant plasmid using the TaKaRaMutanBEST Kit (Takara). All strains were validated using the methods described earlier.
-
bioRxiv - Molecular Biology 2024Quote: ... and plasmid DNA was isolated using NucleoSpin® Plasmid (NoLid) kit for miniprep (740499.250; Takara Bio) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were constructed by PCR amplification of the whole plasmids with the CloneAmp Hifi polymerase (Takara) and assembly of the insert part with the NEBuilder HiFi DNA Assembly kit ...
-
bioRxiv - Bioengineering 2020Quote: ... Original pAUR101 plasmid purchased from Takara Bio ...
-
bioRxiv - Neuroscience 2021Quote: ... and the plasmid encoding DsRed2 (Clontech), cloned into a pCAX vector ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid pEGFPN1 was obtained from Clontech. TMPRSS2-FL cDNA (pcDNA3.1-SARS-2-S-C9 ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmid pRetroX-Tight-Pur (Clontech) and the PCR products have been digested with BamHI and EcoRI ...
-
bioRxiv - Microbiology 2021Quote: The plasmid pPTR I (Takara Bio), which carries the ptrA gene ...
-
bioRxiv - Microbiology 2021Quote: The plasmid pPTR I (Takara Bio) was used to construct the overexpression vector for the A ...
-
bioRxiv - Microbiology 2021Quote: ... or plasmid pPTR I (Takara Bio) were used as template DNA ...
-
bioRxiv - Microbiology 2021Quote: ... and plasmid pPTR I (Takara Bio) were used as template DNA ...
-
bioRxiv - Neuroscience 2022Quote: ... pRC2-mi342 and pHelper plasmids (TAKARA). Seventy-two hours after transfection using Polyethylenimine HCl Max ...
-
bioRxiv - Neuroscience 2019Quote: ... A pmCherry-N1 plasmid (ClonTech, 632523) was utilised as a morphological marker in HEK293 immunocytochemistry experiments ...
-
bioRxiv - Neuroscience 2019Quote: ... A peGFP-N2 plasmid (ClonTech, 632483) was utilised as a morphological marker in subsequent proliferating CTX0E16 experiments due to red fluorescent protein aggregation in CTX0E16 hNPCs.
-
bioRxiv - Neuroscience 2022Quote: ... mCherry of pmCherry-C1 plasmid (Clontech) was subcloned into pAAV-hSyn-EGFP (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pmCherry-C1 from Clontech modified to add a myristoylation and palmytoylation sequence plus a linker (ATGGGCTGCATCAAGAGCAAGCGCAAGGACAACCTGAACGACGA CGGCGTGGACgaaccggtcgccacc ...
-
bioRxiv - Cancer Biology 2022Quote: ... The pEGFP-C1 plasmid (Clontech V012024) was used as the control ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Plasmids were midi-prepped (Takara Bio), and BestGene ...
-
bioRxiv - Neuroscience 2023Quote: ... the eYFP encoding cDNA plasmid (Clontech) was precipitated onto colloidal Au particles (1.6µm ...
-
bioRxiv - Microbiology 2023Quote: ... and isolated by NucleoSpin Plasmid (TaKaRa). The introduced mutation was verified by Sanger sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... into ECFP-C1 expression plasmid (Clontech).
-
bioRxiv - Microbiology 2023Quote: ... pGP packaging plasmid (TaKaRa, Cat# 6160), and pMD2.G plasmid with TransIT-293 Transfection Reagent (TaKaRa ...
-
bioRxiv - Bioengineering 2019Quote: Plasmid pRM01 was made by sequential addition of two DHFR homology regions to plasmid pEGFP-C1 (Clontech). First ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... and used for plasmid DNA preps using the Endotoxin-Free Nucleobond Plasmid Midiprep kit (Takara Bio; 740422.10). The HuEpi library was sequenced and contains all 5,309 sgRNAs included in the synthesis (GSE215430).
-
bioRxiv - Microbiology 2022Quote: ... and used for plasmid DNA preps using the Endotoxin-Free Nucleobond Plasmid Midiprep kit (Takara Bio; 740422.10). The HIVDEP library was sequenced and contains all 4,191 sgRNAs included in the synthesis (GEO Dataset ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmids coding EGFP-mutants were generated from EGFP-IRES-mCherry plasmid using TaKaRa MutanBEST Kit (TaKaRa, Kusatsu, Japan). pG5egfp reporter vector was modified from the pG5luc vector (GeneBank Accession Number AF264724 ...
-
bioRxiv - Bioengineering 2023Quote: The helper plasmid and the AAV-ITR plasmid with a reporter gene (pAAV-ZsGreen1) were acquired from Takara Bio ...
-
bioRxiv - Neuroscience 2019Quote: PLVX-cherry-C1 plasmid was from Clontech and Mtss1L coding region was cloned into the C-terminus of mCherry between BsrG1 and SmaI sites to generate fusion construct of PLVX-cherryC1-Mtss1L (Mtss1L coding region sequence Accession number B) ...
-
bioRxiv - Biochemistry 2020Quote: ... A parent pLVX-TetOne plasmid (Takara Bio) was modified by 1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plasmid pTet-tTs was from Clontech (#631011). A plasmid consisting of human lamin A cloned into pcDNA3.1(+ ...
-
bioRxiv - Microbiology 2021Quote: Plasmids were transformed in Stellar cells (Takara) and prepped for sanger sequencing and lentivirus production ...
-
bioRxiv - Cell Biology 2019Quote: The pMito-DsRed2 plasmid was from Clontech. Addgene provided pcDNA3-mRuby2 (#40260) ...
-
bioRxiv - Cell Biology 2019Quote: pLVX Ires-Neo lentiviral plasmid from Clontech was cut with EcoRI/MluI to remove the IRES-neo cassette ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The Guide-it plasmid vector (Takara Bio) was used to construct CRBN-KO cells ...
-
bioRxiv - Cell Biology 2021Quote: ... a NucleoSnap Plasmid Midi kit (Takara Bio) was used ...
-
bioRxiv - Immunology 2020Quote: ... plasmids were transformed into Stellar Cells (Takara) and grown overnight in 2XYT/carbenicillin cultures ...
-
bioRxiv - Microbiology 2022Quote: ... pGFP-N1 plasmid (Clontech, GenBank accession # U55762) was used for GFP expression ...
-
bioRxiv - Neuroscience 2022Quote: ... The pEGFP-C1 plasmid is from Clontech (Addgene plasmid # 13031 ...
-
Reduction of Spermine Synthase Suppresses Tau Accumulation Through Autophagy Modulation in TauopathybioRxiv - Neuroscience 2023Quote: ... and plasmids expressing EGFP (pEGFP-C1, Clontech) or Tau into SH-SY5Y cells (CRL-2266 ...
-
bioRxiv - Cell Biology 2023Quote: ... The helper plasmid used was pHelper (TaKaRa).
-
bioRxiv - Microbiology 2023Quote: ... utilizing the plasmid pPTR I (TAKARA, Japan) as a template and the primer pairs pHSG396-ptrA-IF-F and pHSG396-ptrA-IF-R ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid transfections were performed using Xfect (Takara) according to the manufacturer’s protocol.
-
bioRxiv - Biophysics 2023Quote: Plasmids were transformed into Stellar cells (Clontech), from which single colonies were picked ...
-
bioRxiv - Microbiology 2023Quote: ... expression plasmid pLVX Tet-One Puro (Clontech) was modified to have a MCS at the 3’end of Tet responsive promoter TRE3GS using EcoR1/BamH1 cut sites ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmids were cloned using InFusion (Takara Bio) and Stellar Competent cells (Takara Bio).
-
bioRxiv - Molecular Biology 2024Quote: ... and tig (pG-Tf2 plasmid, Takara #3340). 1 L of M9 minimal medium supplemented with 1 g 15NH4Cl was inoculated to an OD600 of 0.05 with a LB overnight culture and grown to an OD600 of 0.8 in the presence of chloramphenicol (20 μg/L ...
-
bioRxiv - Cancer Biology 2023Quote: ... plasmids to Lenti-X HEK293T cells (Takara) to generate lentiviral particles for transduction of the target cells as described in detail previously (Elegheert et al. ...