Labshake search
Citations for Takara Bio :
51 - 100 of 1523 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... sad-1 was cloned into PCR8 vector using the following primers 5’ TCCGAATTCGCCCTTCGTCAATCGGGCAAAGTC 3’ and 3 ’GTCGAATTCGCCCTTGATGATAGATTAGACTTTATCAGCC 5’ with help of infusion reaction (Takara, 638947). For making Pmec-7::mec-7::gfp (cDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... with the PCR product of the W56-EGFP-Linker-Synapsin1a region from pAAV-hSyn1-W56-EGFP-Linker-Synapsin1a (FWD and REV primers: 5’-GGCGCGCCCTAGAATTTCAGTCGGAGAAGAGGCTGGC-3’ and 5’-ATGCTAGGCCACCATGATGGTGGACGGCAAGCCC-3’, respectively) using In-Fusion cloning (TaKaRa Bio). pAAV-hSyn1-DIO-Scr-EGFP-Linker-Synapsin1a was generated by replacing the TurboID region of pAAV-hSyn1-DIO-TurboID (EcoRI/NcoI sites ...
-
bioRxiv - Genetics 2024Quote: ... The 4–11 kb fragments of the DFR-B sequence were amplified by PCR using the primers DP-LF (5′-TTAACATGAGGGGATTGCATGTCACTTTCA-3′) and D3U-LR (5′-CATAAATCTGGTTCGAGTGGCAATCTAACT-3′) with Ex-Premier DNA Polymerase (TAKARA, Japan). The PCR conditions were as follows ...
-
bioRxiv - Microbiology 2021Quote: ... UK) containing the 27F/1492R primer set and MightyAmp DNA polymerase Ver.3 (Takara Bio). PCR was performed according to a previous report (Fujiyoshi et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... was amplified using specific primers (forward: 5’-AAGGAGATATACATATGCTCTCCGAAATGGTGGAAGAAG-3’; reverse:5’-GTGCGGCCGCAAGCTTTTATTTCTTTTTGTTGGTGGTCTG-3’) and cloned into pET28a using an InFusion HD Cloning Kit (Takara Bio USA) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio) for the cells following manufacturer protocol.
-
bioRxiv - Molecular Biology 2024Quote: ... The 21 bp barcodes were amplified with 5’-GGGATCACTCTCGGCATGG-3’ forward and 5’-CTGATCAGCGAGCTCTAGGAA-3’ reverse primers and PrimeSTAR GXL DNA polymerase (Takara Bio, Shiga, Japan). They were then sequenced with NextSeq 500 1×150 (Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... and the primers listed in Supplementary Table 3 applying the In-Fusion cloning method (Takara Bio) according to the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... The parasite load in the livers and HepG2 cells was evaluated by Taqman-PCR with primers and probes for 18S rRNA and GAPDH following the manufacturer’s instructions of Premix Ex Taq™ (Probe qPCR) (TAKARA). For the SYBR quantitative PCR assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... and axis sites (YBP1, GRR1) (see qPCR Primer Table) using the TB Green Premix Ex Taq II (Tli RNAse H Plus, Takara).
-
bioRxiv - Microbiology 2024Quote: ... The expression profile of target genes was evaluated using specific primers by using TB green RT-qPCR master mix (Takara) in BioRad Real time PCR instrument or Applied Biosystem QuantStudio-5 system ...
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Cell Biology 2022Quote: ... For gene analysis the cDNA was amplified using gene specific primers by qPCR with Takara 2X SYBR Green Mix (Takara RR420A) and analyzed in real time PCR machine (7500 Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA samples were reverse transcribed using an RT Primer Mix (oligo dT) and PrimeScript RT Enzyme Mix for qPCR (TaKaRa, Japan) following the manufacturer's protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Synthesized cDNA was subsequently mixed with qPCR primers and TB Green Premix Ex Taq (Tli RNase H Plus, RR420A, Takara Bio). Real-time PCR quantification was performed using Cobas z 480 analyzer (Roche Diagnostics GmBH) ...
-
bioRxiv - Microbiology 2023Quote: ... and quantified by RT‒qPCR using Primer/Probe N2 (NIHON GENE RESEARCH LABORATORIES, INC. Miyagi, Japan) and One Step PrimeScript™ III RT‒qPCR Mix (TaKaRa) with CFX96 (Bio-Rad ...
-
bioRxiv - Immunology 2024Quote: ... RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus) (Takara #RR82WR) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and of human FAM104B isoform 3 (NM_001166700.2) were PCR- amplified from a yeast two-hybrid human testis cDNA library (Clontech, cat. no. 638810) and cloned via appropriate restriction sites into pGAD-C1 (James et al ...
-
bioRxiv - Immunology 2021Quote: ... pDsRed-monomer-Golgi-Beta-1,4- galactosyltransferase (Clontech, #632480) and LAMP-RFP (Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... primer design was done using primer design tool (Takara). For inducible expression of the gene ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR for pluripotency and trilineage spontaneous differentiation was performed according to the instruction manual of the human ES cell Primer Array (Takara Clontech).
-
bioRxiv - Microbiology 2020Quote: ... 1) were annealed to a complementary 20-nt primer containing a 5’-fluorescein label (5’FAM-GUCAUUCUCCUAAGAAGCUA-3’, Takara). To perform the primer extension assay ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was annealed to an oligo-dT primer (5’-AAGCAGTGGTATCAACGCAGAGTACT30VN-3’, IDT) in a buffer containing 2.5 mM dNTPs and recombinant RNase Inhibitor (Takara). First-strand synthesis was performed with the SuperScriptII kit using a custom template-switching oligo (5’-/5Me-isodC//iisodG//iMe-isodC/AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... Primers were designed using the primer design tool from Takara Bio (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools) ...
-
bioRxiv - Cell Biology 2020Quote: ... a beta-galactosidase staining kit (Takara-bio, Shiga, Japan) was used according to the provider’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... U6 primers (TAKARA) were used to normalize miRNA expression via the 2-ΔΔCq method (ΔCq = Cqtarget − Cqrereference).
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR for pluripotency and trilineage spontaneous differentiation was performed according to the instruction manual of the human ES cell Primer Array (Takara Clontech).
-
bioRxiv - Cell Biology 2020Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′-GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: ... The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196) and Atcox1-3’(+17..+38) using Ex Taq Hot Start Version (Takara). The thermal cycling program consisted of initial 4 minute-denaturation at 95°C ...
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Takara).
-
bioRxiv - Cell Biology 2022Quote: ... a polymerase chain reaction using 5’-TCTAGAGCTACTAACTTCAGCCTGCTG-3’ / 5’ - CGGTGGATCCCCTTCTTCC-3’ primers on Ibidi USA 60101 LifeAct-GFPtag2 plasmid was cloned with In-Fusion HD enzyme kit (Takara) into the pLVX vector (Clontech ...
-
bioRxiv - Microbiology 2023Quote: ... pAAV-UGI was constructed by cloning the entire coding sequence of UGI amplified from pBS-UGI-flag by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pAAV-ZsGreen1 (TaKaRa).
-
bioRxiv - Molecular Biology 2023Quote: ... linearized by PCR and using the divergent primers reported in Supplementary Table 3 and CloneAmp™ HiFi PCR Premix (Takara) polymerase ...
-
bioRxiv - Microbiology 2023Quote: ... by PCR using the primers shown in S-Table 3 into the EcoRI and BamHI sites of pRetroX-TRE3G (TaKaRa). pBS-UGI-flag was constructed by amplifying the UGI and flag sequence from UGI- pFERp44 by PCR and cloning it into the NotI and EcoRI sites of pBluescript II KS(+ ...
-
bioRxiv - Microbiology 2024Quote: ... The expression profile of target gene was evaluated using specific primers (Table-3) by using SYBR green RT-PCR master mix (Takara) in BioRad Real time PCR instrument ...
-
bioRxiv - Genomics 2020Quote: ... The cDNA synthesis was carried out by using 5 g of total RNA or 1 g of PAPed RNA with RT primer (5-TTTTTTTTUUUTTTTTVN-3) by PrimeScript II Reverse Transcriptase (TaKaRa Bio). The full-length cDNAs were selected by Cap Trapper method 60 ...
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Zoology 2023Quote: ... Primers were designed on each contig (Table S3) and RT-PCR was performed using a 3’ RACE CORE Set (Takara Bio).
-
bioRxiv - Molecular Biology 2023Quote: ... Promoterless bicistronic vectors were generated by removing the SV40 promoter from the bicistronic vector pRUF and the pRUF vectors containing the putative IRES sequences by PCR amplification using divergent primers (Supplementary Table 3) and the CloneAmp™ HiFi PCR Premix (Takara) polymerase ...
-
bioRxiv - Molecular Biology 2022Quote: ... Random Primer Mix (Takara) and 200 U SMARTScribe Reverse Transcriptase (Takara) ...
-
bioRxiv - Biochemistry 2020Quote: ... PTGS2 (qPCR, Takara) and MDA (SIGMA ...
-
bioRxiv - Physiology 2021Quote: ... and quantitative primers (Perfect Real Time Primer, Takara, Shiga, Japan, Supplemental Table S1). The expression was normalized to GAPDH within each sample.
-
bioRxiv - Genetics 2020Quote: ... qPCR was performed with the SYBR Fast qPCR Mix (Takara, RR430A) in the Applied Biosystems 7900 Real-Time PCR System ...
-
bioRxiv - Cell Biology 2021Quote: ... Sanger sequencing was performed after PCR amplification with appropriate primers (Fw#3 and Rv#4, S1 Table) and PrimeSTAR HS DNA Polymerase (Takara, Kyoto, Japan).
-
bioRxiv - Plant Biology 2023Quote: ... PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM, Clontech) with KOD One PCR Master Mix (TOYOBO ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-qPCR was performed with a SYBR PrimeScript RT-qPCR Kit (Takara) for 40 cycles at 95°C for 5 s and 60°C for 30 s on a Light Cycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Cancer Biology 2022Quote: ... and quantitative qPCR was conducted using SYBR Green qPCR Master Mix (TaKaRa) on the 7500 Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and analysed via qPCR using the SYBR qPCR Premix Ex Taq (Takara) in a 7300 Real-Time PCR System (Applied Biosystems) ...