Labshake search
Citations for Takara Bio :
1 - 50 of 1523 citations for Human TGF beta 3 TGFB3 qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... The primer pairs were synthesized by TaKaRa and displayed in Table EV3.
-
bioRxiv - Biochemistry 2023Quote: ... The endogenous pfrkip locus was targeted by cloning 20 nucleotide guide region (5’-ATAATTGGTGCCAAATTGAA-3’) with primer pair GRKIPV5F/ GRKIPV5R using In-Fusion (Clontech, Mountain View, CA) in pL6eGFP plasmid [53] generating pL6eGFPgV5 plasmid ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 3′-RACE CDS primer (ClonTech) for cDNA synthesis from 5,4 μL uf viral RNA ...
-
bioRxiv - Neuroscience 2024Quote: ... reverse primer (5’-caccgccatggtggcggatcccttgtacagctcgtccatgcc −3’) (Clontech).
-
bioRxiv - Neuroscience 2024Quote: ... reverse primer (5’-cacgtctcatcccctccatctttgacctttcaaagtg - 3’) (Clontech). The full-length Tenm4 cDNA ...
-
bioRxiv - Immunology 2024Quote: ... and 3′-RACE CDS primer (Clontech). Next ...
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Cell Biology 2021Quote: ... The HBV core protein coding region was amplified using the forward primer 5’-ATCATAAGCTTACCATGGACATCGACCCTTATAAAG-3’ and reverse primer 5’-TAGATGGTACCCTAACATTGAGGTTCCCGAG-3’ and subcloned into the pcDNA3.1 vector (Clontech) via HindIII and KpnI restriction sites ...
-
bioRxiv - Genomics 2021Quote: ... primer pairs specific for each investigated enhancer were used for PCR amplification with the EpiTaq HS polymerase (TaKaRa). Finally ...
-
bioRxiv - Molecular Biology 2024Quote: The oligonucleotide library was amplified with a pair of primers using PrimeSTAR® Max DNA Polymerase (Takara Bio). The P8 and P3 phagemids were double-digested using NcoI-HF® (NEB ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Microbiology 2022Quote: ... Then 50 nl of primer pair solution mixed with 1X SmartChip TB Green Gene Expression Master Mix (Takara Bio) were loaded onto the SmartChip ...
-
bioRxiv - Microbiology 2023Quote: ... using Psme1Sal1-F/Psme1BamHI-R primer pairs (Table S4) and cloned as a Sal1/BamH1 fragment into pEGFPC1 (Clontech). For production of GST- and His6-Myc-fusion proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... The Human Mitochondrial DNA Monitoring Primer Set (TaKaRa, Cat # 7246) was used to determine mitochondrial DNA (mtDNA ...
-
bioRxiv - Genetics 2020Quote: ... and complementary primer pairs (sequences available on request) was used to generate TMEM127 variants in the pEGFP-C2 (Clontech Laboratories) and pCMV6-XL5 (Origene ...
-
bioRxiv - Genetics 2020Quote: ... Three overlapping MTM1 cDNAs were amplified using three pairs of cDNA primers from Tosch et al(Tosch et al. 2010) using the PrimeSTAR GxL kit (Takara). Primers are F1/R1 (ATGGCTTCTGCATCAACTTC / TGGAATTCGATTTCGGGAC ...
-
bioRxiv - Microbiology 2024Quote: Each individual SARS-CoV-2 fragment was amplified from their respective plasmids using an exclusive pair of primers (Supplementary Table 2) and high-fidelity PrimeSTAR GXL DNA polymerase (Takara), followed by gel isolation with NucleoSpin Gel and PCR Clean-up (Macherey-Nagel ...
-
bioRxiv - Molecular Biology 2022Quote: ... qRT-PCR was performed using first-strand cDNA and a primer pair designed for target genes using the SYBR Premix Ex Taq Perfect Real Time Kit Tli RNAaseH Plus (TAKARA) and Thermal Cycler Dice Real Time System (Model TP800 ...
-
bioRxiv - Biochemistry 2023Quote: The gene encoding XccOpgD (GenBank: AAM43366.1) was amplified by PCR with the primer pair shown in Supplementary Table 1 using PrimeSTAR Max (Takara Bio) and a genomic DNA of X ...
-
bioRxiv - Molecular Biology 2021Quote: ... A pair of gene specific primers TaAFR-F and TaAFR-R (S1 Table) and Tks Gflex™ DNA Polymerase (TaKaRa, Japan) were used to amplify the full-length coding sequences CDS amplified with Tks Gflex™ DNA Polymerase (TaKaRa ...
-
bioRxiv - Microbiology 2021Quote: ... Then PCR application using specific primer pairs (Supplemental Table 2) designed for H7N9 virus and Takara One-step RT-PCR kit (Takara, China) segment by segment ...
-
bioRxiv - Immunology 2024Quote: ... Two-step PCR to amplify gag or pol region was performed with eight different primer pairs (Supplemental Table 1) and Ex-Taq (TaKaRa-Bio) as described previously (17) ...
-
bioRxiv - Plant Biology 2020Quote: ... was then used for RT-qPCR with the primers shown below with THUNDERBIRD® qPCR Mix (TOYOBO) on a Thermal Cycler Dice Real Time System (Takara Bio). Radish Glyceraldehyde 3-phosphate dehydrogenase (GAPDH ...
-
bioRxiv - Microbiology 2020Quote: ... The erythromycin resistance gene was amplified from plasmid pMG36e using primer pair EmrF/EmrR and then connected with linearized pMD19-GmloxP using In-Fusion HD Enzyme (Takara, Daliang, China), generating the plasmid pMD19-EmrloxP ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Plant Biology 2022Quote: ... (RT-qPCR) in the presence of SYBR Green (TaKaRa TB Green Primer Ex TaqII, #RR820Q) was carried out using a BioScript PCR kit (Bioline ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-qPCR in the presence of SYBR Green (TaKaRa TB Green Primer Ex TaqII, #RR820Q) was carried out according to the manufacturer’s instructions in a BioRAD CFX 384 Thermal Cycler (BioRAD ...
-
bioRxiv - Developmental Biology 2021Quote: ... Specific forward and reverse primers (Suppl Table 3) were designed using the In-Fusion Cloning Primer Design Tool from TaKaRa (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Biophysics 2024Quote: ... or into pET32a vector pET32a-TGF-β2-(Q57A, K60A, L64A), pET32a-TGF-β2-(Y50A, L51A) using In-Fusion seamless cloning (Takara Bio). SNAP-BG was constructed using overlapping PCR ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed using specific primers mixed with the TB Green Premix Ex Taq (Takara, Japan) in a 20 μl reaction system ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV was titrated using quantitative PCR (qPCR) with primers for the ITR sequence (TaKaRa Bio Inc).
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Microbiology 2023Quote: ... transcripts of the target genes were amplified with the corresponding primer pairs (S2 Table) and quantified with SuperReal PreMix Plus (SYBR Green) (Takara biomedical technology, Beijing, China), using the 18S rRNA was used as control ...
-
bioRxiv - Systems Biology 2022Quote: ... Optimized coding sequences were synthesized as gBlocks (Integrated DNA Technologies) carrying 16-base pair overhangs at the 5’ and 3’ ends to facilitate in-fusion cloning (Clontech) into pET expression vectors (EMD MIllipore).
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The FOXR1 wild-type and M280L mutant were then PCR amplified using forward 5′-AAAGCACTCGAGATGGGGAACGAGCTCTTTCTG-3’andreverse5’-TTTGGCCCGCGGTTAAAGATCAAAGAGGAAGGG-3’ primers and subcloned into the XhoI and SacII restriction sites of pEGFP-C3 (Clontech) to create an N-terminal EGFP tag ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Microbiology 2023Quote: ... The V1-V2 variable region of stool DNA was amplified by universal primer set 27F-mod (5’-AGRGTTTGATYMTGGCTCAG-3’) and 338R (5’-TGCTGCCTCCCGTAGGAGT-3’) using Gflex DNA polymerase (Takara) 37 ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was then performed using gene-specific primers (Table S1) and TB Green Premix Ex Taq (Takara). Levels of gene expression were normalized to that of 16S ribosomal RNA gene (OL4498 and OL4449 ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was then performed using gene-specific primers (Table 2) and TB Green Premix Ex Taq (Takara). Levels of gene expression were normalized to that of 16S rRNA and expression was assessed for each biofilm and each timepoint relative to its planktonic counterpart using the 2−ΔΔCt method (43).
-
bioRxiv - Evolutionary Biology 2021Quote: First amplified with primers 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) using EmeraldAmp GT PCR Master Mix (TAKARA BIO) to minimize the amplification of non-bacterial taxa under the following cycling conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... D4H was generated by site-directed mutagenesis using the primers 5’-TGTTTTAGATTGATAATTTCCATCCCATGTTTT-3’ and 5’-CGGACTCAGATCTCGAAGGGAAAAATAAACTTAGA-3’ and inserted into pEGFP-C2 vector (TaKaRa Bio) by the In-Fusion reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... was amplified from HEK293 cDNA by PCR using the primers 5’-TGTAAGCTTTTCGACACCACACCCCACTC-3’ and 5’-AGAGAATTCTCAGGAAAAGCTGTCATCGG-3’ and was inserted into pEGFP-C3 vector (TaKaRa Bio) using EcoRI and HindIII ...