Labshake search
Citations for Takara Bio :
801 - 850 of 2621 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The viral RNA copy number was standardized using a SARS-CoV-2 direct detection RT-qPCR kit (Takara). Fluorescent signals from resulting PCR products were acquired using a Thermal Cycler Dice Real Time System III (Takara).
-
bioRxiv - Plant Biology 2024Quote: ... benthamiana leaves at 2 days post-agroinfiltration (dpa) using the PrimeScript RT Reagent Kit (Perfect Real Time, Takara) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: The fusion PCR reaction system (50 μl) consisted of 25 μl of 2 PrimeSTARMax Premix (TaKaRa, Dalian, China), 3 μl of 10 mM sgRNA-F ...
-
bioRxiv - Immunology 2024Quote: ... 0.5mL T cells at 2 × 106 cells mL-1 were mixed with 1.5mL lentiviral supernatant and centrifuged in 24-well plates pre-coated with 7 µg mL-1 Retronectin (Takara Bio, San Jose, USA) at 1000 x g for 20min ...
-
bioRxiv - Immunology 2024Quote: ... containing 0.5 ml of a 1:1 solution of phosphate-buffered saline (PBS):FBS supplemented with ribonuclease inhibitor (1:100; Takara Bio). For some samples ...
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 million Lenti-X HEK-293T cells (Takara Bio, cat. no. 632180) were seeded in 9 mL DMEM (Gibco ...
-
bioRxiv - Neuroscience 2023Quote: ... the mouse monoclonal anti-GFP (Jl-8, Clontech; 1:500 overnight at 4°C) primary antibody was used ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.3 μM gene-specific forward/reverse primers and 2 μL of diluted cDNA using a thermal cycler Dice (Takara). The reactions were carried out as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 μM ROCK inhibitor (Y-27632; Selleckchem, Cat. No. S1049) and 2 μg/mL doxycycline (Clontech, Cat. No. 631311). Media was changed daily during this stage.
-
bioRxiv - Microbiology 2021Quote: ... CPER mixtures contained 0.1 pmol of each DNA fragment and 2 µl of PrimeStar GXL DNA polymerase (Takara, Japan) in a total reaction volume of 50 µl ...
-
bioRxiv - Cell Biology 2021Quote: ... The culture was split into two 2-mL cultures of which one was supplemented with 250 nM rapalog (Clontech). Parasite growth was determined via flow cytometry over five days as described above ...
-
bioRxiv - Cell Biology 2022Quote: ... The yeast was transformed with the indicated plasmids using the Matchmaker™ Yeast Transformation System 2 (Clontech, Cat#: 630439). Two plasmids containing simian virus (SV ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2021Quote: ... His-tagged NTD domain constructs were purified from clarified supernatants using 2 ml of cobalt resin (Takara Bio TALON), washing with 50 column volumes of 20 mM HEPES-HCl pH 8.0 and 150 mM NaCl and eluted with 600 mM imidazole ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Biochemistry 2022Quote: ... and ligated into the multiple cloning site 2 (MCS2) of the pTRE3G-BI vector (Clontech, Mountain View, CA, USA), resulting in the construct pTRE3G-BI/GPR83-LgBiT ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Neuroscience 2024Quote: ... in BrainPhys neuronal media (composed according to Bardy et al. 2015)74 and 2 µg/ml doxycycline (Takara 631311). Three days after plating and ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA encoding FLAG-Rhino was cloned into pPB-2× Ty1-Tjen-EGFP-P2A-BlastR51 using In-Fusion cloning (TAKARA), bearing pPB-FLAG-Rhino-Tjen-EGFP-P2A-BlastR ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 2.6 x 106 yeast transformants were screened on 2% SD/Gal/Raf/X-P-gal (-Ura/-His/-Trp/-Leu) following the manufacturer’s instructions (Clontech). Direct protein-protein interaction was confirmed by co-transformation of the respective plasmids into the yeast strain AH109 using the Matchmaker GAL4 Two-hybrid System (Clontech) ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Plant Biology 2023Quote: ... Yeast transformation was performed as described in the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, TaKaRa Bio, USA). Serial dilution of transformed colonies were dropped on –Trp/-His synthetic dropout selection medium ...
-
bioRxiv - Genetics 2023Quote: ... The transformation process followed the protocol described in the Yeastmaker™ Yeast Transformation System 2 User Manual (Takara Bio), yielding approximately 2 × 106 and 7 × 106 transformants for LE9 and BLX strains ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by the addition of 2.8 μL quenching buffer (0.7 μL of Triton X-100 [Nacalai Tesque], 0.7 μL of 2% bovine serum albumin [BSA] [Takara Bio]) and incubation at 70°C for 90 sec to quench the denaturing effect of SDc ...
-
bioRxiv - Molecular Biology 2023Quote: ... and then used as the template to synthesize double strand cDNA amplicons by PCR (optimal 17 – 21 cycles) using Advantage 2 PCR kit according to the manufacturer’s specifications (Clontech). cDNA was purified using NucleoSpin Gel and PCR Clean-up kit (Takara Bio) ...
-
bioRxiv - Cancer Biology 2023Quote: ... His-TEV tagged protein was captured with Co-TALON resin (Clonetech, Takara Bio USA, 2 mL slurry/liter culture) at 4 ºC for 1 h with constant end-to-end mixing ...
-
bioRxiv - Biochemistry 2023Quote: ... The membrane was incubated for 1 h at room temperature with Odyssey blocking buffer and 0.2 % PBS-T (PBS containing 0.2 % (v/v) Tween-20) with rat anti-HA clone 3F primary antibody (Clontech) at 1:1,000 dilution ...
-
bioRxiv - Microbiology 2024Quote: ... The protein-bead mixtures were then loaded onto a gravity column (TALON 2 mL Disposable Gravity Column, Takara #635606). Lysate was loaded into the column 5 times with gravity flow and then washed in a 1M NaCl buffer 3 times ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... CHO-K1 cells were transiently co-transfected with 2 µg KV4.3 (cloned into pBK- CMV vector, amplified by PCR and ligated into pmCherry-C1 (Clontech), by using XhoI and HindIII restriction sites,23 and 1 µg KChIP2 (cloned into IRES mCherry KChIP2 using XbaI and XhoI restriction sites).
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with antibodies against GFP (anti-GFP.1, 4°C overnight, Takara Bio Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with antibodies against GFP (anti-GFP.1, 4°C overnight, Takara Bio Clontech, 632381 or anti-GFP.2 ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were washed twice with 20 mL of D-PBS (Nacalai Tesque) and resuspended in CELLBANKER 1 (Takara Bio) at 1 × 107 cells/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2020Quote: ... A mouse 7-day embryo cDNA Library (CATALOG No. 630478; Clontech Laboratories, Inc.) was used to identify host interaction proteins of Mtb PknG through yeast two-hybrid assay ...
-
bioRxiv - Developmental Biology 2022Quote: ... Three transformation reactions were performed with 2 µl of the reaction mixture in 50 µl Stellar− Competent Cells (636763, Takara) each according to the manufacturer’s manual ...
-
bioRxiv - Molecular Biology 2021Quote: ... The first stranded cDNA was next amplified to produce double stranded cDNA in 20 amplification cycles by long distance PCR using the Advantage 2 polymerase mix (Takara, Clontech) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... PCRs were performed on board using 25 ng of DNA from each coral sample with the Advantage 2 kit (Takara Clontech) and a final primer concentration of 0.5 μM in a final reaction volume of 50 μl ...
-
bioRxiv - Microbiology 2021Quote: 293T were transfected with full length SARS-CoV-2 Spikes and a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) using the calcium-phosphate method ...
-
bioRxiv - Cell Biology 2021Quote: ... Expression of shRNA targeting and knocking-down Eklf was induced by the addition of 2 µg/ml of doxycycline (Clontech) for 96 hr ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... PreS2-LHBS sequence (deletion nucleotides 2-55) was cloned into the protein stability construct after the c-terminal of EGFP by In-Fusion cloning (Takara). The protein stability construct was a kind gift from Dr ...
-
bioRxiv - Microbiology 2022Quote: ... Each of these prey plasmids and previously constructed bait plasmids were co-transformed into Y2HGold yeast strain using Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformation mix was spread on DDO/X and QDO/X/A agar plates and incubated at 30°C for 3-5 days ...
-
bioRxiv - Microbiology 2022Quote: ... The purified ds cDNA and SmaI linearized pGADT7-Rec were co-transformed into Y187 yeast strain using Yeastmaker Yeast Transformation System 2 (TaKaRa). The transformation mix was spread on to the SD/-Leu agar plates and incubated at 30°C for 3–4 days ...