Labshake search
Citations for Takara Bio :
701 - 750 of 2621 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Co-transformants were selected by cultivation for 2 days on minimal synthetic defined (SD) media (Clontech) lacking Leu (pACT2-GW ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Molecular Biology 2021Quote: Primers were designed using the Takara Bio Perfect Real Time Support System (Takara Bio, Table 2). Primers were diluted to 50 µM in ddH20 and stored at -20°C ...
-
bioRxiv - Physiology 2021Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2022Quote: ... Yeast transformation was performed according to the Yeastmaker Yeast Transformation System 2 User Manual (Clontech, Japan). The primers used are listed in Supplemental Table S1.
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RBDs were purified using a Cobalt affinity column (HisTALON Superflow column from Takara or HiTrap TALON crude column from Cytiva ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Biochemistry 2023Quote: ... LayV G was purified from clarified supernatants using 2 mL of cobalt resin (Takara Bio TALON), washing with 200 column volumes of 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2023Quote: Yeast two-hybrid assays were performed according to the Yeastmaker Yeast Transformation System 2 manual (Clontech). The yeast strain AH109 was co- transformed with an AD-fused and a BD-fused construct using the lithium acetate method ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Second strand synthesis and PCR amplification was performed by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 100 ng of genomic DNA was amplified with Advantage GC 2 polymerase (Takara Bio 639114) using 1 M GC Melt and primers spanning the region from upstream of the splice donors to the 3’ end of the repeat ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viral supernatant was collected 2 days post-transfection and concentrated using Lenti-X lentivirus concentrator (Clontech). Cells were then infected with the concentrated lentivirus ...
-
bioRxiv - Plant Biology 2024Quote: ... First-strand cDNA was synthesized using 2 μg RNA and PrimeScript RT Master Mix (Takara Bio). qRT-PCR was performed using the first-strand cDNAs diluted 5-fold in water and KAPA SYBR FAST qPCR Master Mix (2x ...
-
bioRxiv - Molecular Biology 2024Quote: ... Second strand synthesis and PCR amplification was done by adding the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pM ...
-
bioRxiv - Plant Biology 2024Quote: ... The 20-ml reaction mixture contained 10 ml of 2× TB Green Premix Ex Taq (Takara), 2 ml of diluted complementary DNA (1:5) ...
-
bioRxiv - Bioengineering 2024Quote: ... 500 ng of RNA was mixed with 2 μl of PrimeScriptTM RT reagent kit (TaKaRa, RR037B) and distilled water (DW ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The supernatant was applied to 2 mL slurry of TALON Metal Affinity Resin (Takara Bio #635504) and nutated for 1 hour to allow TALON to bind the His tagged protein ...
-
bioRxiv - Cancer Biology 2020Quote: ... Amplified cDNA from the ICELL8® 3’ DE Chip individual cells was collected and pooled using the ICELL8® Collection Kit (Takara Bio) by centrifugation at 3,200 x g ...
-
bioRxiv - Microbiology 2020Quote: pEX18Tc-hpdA was constructed for gene knockout by fusing the erythromycin resistance gene and two upstream and downstream fragments of the target gene amplified with the primers shown in Table 3 to Sac I/Hind III-digested pEX18Tc with the In-Fusion® HD Cloning Kit (TaKaRa, Dalian, China). The resulting plasmid pEX18Tc-hpdA was transformed into E ...
-
bioRxiv - Microbiology 2023Quote: ... or the BamHI/MluI site of pWPI-ACE2-zeo (for ACE2 expression plasmids)43 with 3×FLAG-tag at the C-terminus using In-Fusion® HD Cloning Kit (Takara, Cat# Z9650N). Nucleotide sequences were determined by DNA sequencing services (Eurofins) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transfected cells were cultured for over 3 weeks in complete RPMI-1640 medium containing G418 (600 μg/ml; Clontech, Palo Alto, CA, USA) to select resistant clones.
-
bioRxiv - Neuroscience 2023Quote: ... Media containing lentiviral particles was collected 72 hours post-transfection and the lentiviral particles were precipitated with 3 volumes of Lenti-X Concentrator (Takara, cat. no. 631232) at 4°C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... Blots were probed for 1h at room temperature (RT) with a mouse anti-GFP antibody (Living Colors -JL-8, BD Biosciences Clontech) in TBS-T buffer (20 mM Tris ...
-
bioRxiv - Neuroscience 2024Quote: ... 7 million Lenti-X HEK-293T cells (Takara Bio, 632180) were seeded in 9 mL DMEM ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:4 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 2 and 10 column volumes of Membrane Buffer 2 with 20 mM imidazole before elution with Membrane Buffer 2 with 300 mM imidazole ...
-
bioRxiv - Neuroscience 2024Quote: ... The non-solubilized fraction was separated by centrifugation at 47850 x g for 1 h at 4 °C and 4 mL of cobalt-charged TALON resin (Clontech, Takara) was added to the solubilized fraction for batch binding (3 h at 4 °C) ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were cotransfected with hSyn-DsRed and the indicated construct on DIV 7 or DIV 19 (for older neurons) with 1 μg total purified plasmid DNA via CalPhos Mammalian Transfection Kit (Takara Bio) according to the manufacturer’s protocol.
-
bioRxiv - Plant Biology 2020Quote: ... incubated overnight at 4°C with anti-GFP (Takara 632380, 1:10000), washed in TBS-T ...
-
bioRxiv - Biophysics 2021Quote: ... denatured at 85°C for 5 minutes and annealed at 47.5°C for 4 hours in a PCR machine (Takara-Bio). The folded DNA origami was then agarose-gel-purified (Douglas et al ...
-
bioRxiv - Genomics 2020Quote: ... RNase Inhibitor (0.4 U) and 1.92 μM of the 3’ oligo dT terminating primer: SMART-Seq® ICELL8® CDS (Takara Bio USA, CA, USA).
-
bioRxiv - Biochemistry 2021Quote: ... (ii) addition of a second adapter on the 3’ end of the cDNA during reverse transcription using SmartScribe RT (Clontech Biotechnologies, Mountain View, CA) as previously described (63) ...
-
bioRxiv - Immunology 2020Quote: ... Virus concentration was estimated by p24 titration using the FLAQ assay76 (HIVGKO and VLPs) or the Lenti-X™ p24 Rapid Titer Kit (Clontech; HIVNL4-3/Luciferase).
-
bioRxiv - Developmental Biology 2020Quote: ... Lentiviral supernatant titers were determined by Lenti-X p24 Rapid Titer Kit (supplemental Table 3) according to manufacturer’s protocol (Takara Bio USA, Inc. California, U.S.A).
-
bioRxiv - Developmental Biology 2021Quote: PCR products were subcloned in frame with GFP sequence in 3′ into pCS2+-GFP vector using In-Fusion® HD Cloning Kit (Takara Bio USA, Inc.). For rescue experiments ...
-
bioRxiv - Neuroscience 2022Quote: Jacob-LMO4 interaction was reconfirmed using fusion vectors (bait vector pGBKT7, prey vector pGADT7) using MATCHMAKER Two-Hybrid System 3 (Takara Bio Europe/Clontech, France). Co-transformed yeasts were assayed for growth on quadruple drop-out medium (SD/–Ade/–His/–Leu/–Trp ...
-
bioRxiv - Cell Biology 2024Quote: ... Ten nanograms of RNA were used for preparing indexed libraries using SMARTer Stranded Total RNA-Seq Pico-Input Mammalian kit v.3 (Takara Bio. Cat# SKU: 634487) as per manufacturer’s instructions (except that fragmentation was performed for 3 minutes of fragmentation at 94 °C and 13 cycles was used for PCR2) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reactions at every examined depth were performed in triplicate (n=3) using Takara SpeedSTAR HS DNA polymerase kit (Takara Bio USA, Madison, WI) with the following modifications ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting vectors were transformed into yeast strain AH109 according to Matchmaker™ GAL4 Two-Hybrid System 3 protocol (Clontech, Mountain View, CA, USA).
-
bioRxiv - Microbiology 2024Quote: ... hdhfr and ef-1α 3’NR were cloned into the BamHI site of pBluescript SK using In-Fusion HD Cloning Kit (Takara Bio Inc., Otsu, Japan). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... Ten nanograms of RNA were used for preparing indexed libraries using SMARTer Stranded Total RNA-Seq Pico-Input Mammalian kit v.3 (Takara Bio. Cat# SKU: 634487) using manufacturer’s instructions with a couple of modifications ...
-
bioRxiv - Cell Biology 2023Quote: ... Release of TfR from the ER was triggered by adding D/D solubilizer (Takara Bio) to the live-cell imaging solution at a final concentration of 1 µM.
-
bioRxiv - Immunology 2020Quote: Levels of p24 antigen in the purified SARS-CoV-2 pseudotype solution was measured by ELISA (Takara). Mouse sera were heat inactivated ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was amplified from WT genomic DNA by PCR using Advantage 2 Polymerase (#639202, Takara Bio, USA). Plasmid backbones were double-digested with the necessary restriction enzymes and purified using the Qiagen DNA purification kit (#28704X4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 50% fresh RPMI medium supplemented with 20 U/ml IL-2 and spin-fected on RetroNectin (Takara)-coated plates at 3000 g at 32°C for 2 h ...