Labshake search
Citations for Takara Bio :
1001 - 1050 of 2621 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq ...
-
bioRxiv - Cancer Biology 2024Quote: ... RT-PCR was performed using diluted cDNA (1:5 in water) and PrimeStar DNA Polymerase (Takara, R010A) with primers and PCR conditions listed in Table 1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gal4-VP16-human SREBP-1c plasmid was prepared by insertion of a VP16-transactivation domain fused to a human SREBP-1c fragment from the 431st amino acid to the C-terminus (amino acids 431-1123) downstream of the Gal4-DNA binding domain sequence in pM vector (Clontech). The Gal4-RE-Luc plasmid and luciferase plasmid including sterol response element (SRE-Luc ...
-
bioRxiv - Cell Biology 2021Quote: ... Borr open reading frame corresponding to amino acids 113-221 was first amplified with a stop codon from LD36125 by PCR using PrimeStar (Takara) and cloned between AscI and NotI sites of pENTR (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... CPE 451 mCherry constructed by Gibson assembly by sub-cloning the 451 amino acids of CPE (without the Amphipathic Helix) into pmCherry-N1 (Clontech) vector using XhoI and BamHI restriction sites.As control vectors we used pEGFP-N3 and pmCherry-N1.All constructs were sequenced to confirm the fidelity of the process ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... A Flag tag x3 was inserted between amino acids 489 and 490 and a HA tag was inserted between amino acids 724 and 725 using In-Fusion Cloning Mix (Takara).
-
bioRxiv - Neuroscience 2023Quote: ... inserting an in-frame 15bp flexible linker sequence (encoding the amino acids GGGGA) followed by EGFP at the C-terminus using Infusion cloning (Clontech). For the Tg(NBT:ap2s1-gfp ...
-
bioRxiv - Microbiology 2024Quote: ... Dropout medium and plates were prepared with DifcoTM Yeast Nitrogen Base without Amino Acid (Becton Dickinson) and DO supplements (Clontech) following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... plasmids respectively using primers HindIII_ZIKV_sfRNA and XbaI_GFP (Supplementary table 7) and PrimeSTAR GXL Polymerase (Takara, Japan). Cycling conditions were as follows ...
-
bioRxiv - Biophysics 2021Quote: ... The 7-kb band was excised and recycled using Agarose Gel DNA Extraction Kit (TaKaRa Bio). Concurrently ...
-
bioRxiv - Cell Biology 2022Quote: MCF-7 and T47D cells were harvested and total RNA was extracted with RNA Trizol (TAKARA) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μG (636224-Takara) using 1 μl from each ...
-
bioRxiv - Cell Biology 2021Quote: ... (5 μg with Takara Clontech Xfect in NRVMs ...
-
bioRxiv - Immunology 2024Quote: ... DTT (5 mM, Takara), recombinant RNase inhibitor (1 U/uL ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Bioengineering 2024Quote: ... To synthesize cDNA, total RNA (8 µL, ca. 500 ng) was mixed with 2 µL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Microbiology 2024Quote: ... the ORF4 region was amplified by RT-PCR with specific primers (Supplementary Table S2) using PrimeScript One Step RT-PCR Kit Ver.2 (Takara Bio Inc., Kusatsu, Japan), following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... with 2 ul of RNAse inhibitor mix (containing 0.12 ul Triton X-100 10 %, 0.1 ul RNAse inhibitor (Takara (Cat. No. 2313B, 40 U/ul), 1.78 ul MilliQ water (RNAse-free)) ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an incubation overnight at 4°C with antiDsRed rabbit polyclonal primary antibody (1:1000, 632496 Takara Bio) diluted in a triton buffer (0.3% Triton X-100 diluted in PBS-DEPC) ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an incubation overnight at 4°C with antiDsRed rabbit polyclonal primary antibody (1:1000, 632496 Takara Bio) diluted in a triton buffer (0.3% Triton X-100 diluted in PBS-DEPC) ...
-
bioRxiv - Biophysics 2021Quote: ... The resulting supernatant was collected by ultracentrifugation (150,000 × g, 1 hour, 4 °C) and applied onto an immobilized metal-ion affinity chromatography column (Talon, Clontech) equilibrated with 40 mM Tris ...
-
bioRxiv - Immunology 2020Quote: ... non-tissue culture treated 96-well plates were coated overnight at 4 °C with 1 ml of retronectin (Takara) at 25μg/ml in PBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... They were then incubated O/N at 4°C with the corresponding primary antibody: anti-DsRed (1:500; Clontech), mouse anti-GFP ([1:100] ...
-
bioRxiv - Cancer Biology 2024Quote: ... sections were stained overnight in 4°C with primary antibodies: human cytoplasmic antigen (1:1000, clone STEM121, Takara, Y40410), OLIG2 (1:1000 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... which contains a six-amino acid His-tag for the creation of a N-terminal fusion using the In-Fusion HD cloning kit (Clontech, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... two to three amino acids in GFP-SP-BAP were replaced by alanine for each construct using the CloneAmp HiFi PCR Premix (Takara Bio) according to the manufacturer.
-
bioRxiv - Biochemistry 2021Quote: ... Add 25 mL 200 g/L glucose and 25 mL 20 g/L amino acid drop-out mix (Clontech. Inc., Japan) solution to prepare the medium] ...
-
bioRxiv - Neuroscience 2022Quote: ... Pak1 fragment (amino acids 270–521) was PCR-amplified from pCMV6M-Pak1 and subcloned into pCold-Pros2 vector (Takara Bio Inc.) to generate pCold-Pros2-Pak1cat ...
-
bioRxiv - Immunology 2023Quote: ... The expression vectors for the S variants with multiple amino acid changes or deletions were generated using the In-Fusion HD cloning kit (Takara Bio). The pcDNA3.1-hACE2 used to express human ACE2 (hACE2 ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were diluted in 5% milk in PBS-T + 0.01% sodium azide (1:2,000 for mouse anti-GFP (Clontech) and mouse anti-3V5 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... A2058 and MDST8 as previously described (7) with small changes for adherent cell lines omitting RetroNectin (Clontech). LCL-1 was transduced with single minigenes ...
-
bioRxiv - Neuroscience 2023Quote: Neurons were transfected at day in vitro (DIV) 7 using CalPhos Mammalian Transfection Kit (Takara Bio, 631312). Transfection solution was prepared by adding 1.5 µg DNA per construct (3 µg in total ...
-
bioRxiv - Neuroscience 2024Quote: ... The PCR-amplified promoter fragments were inserted into the XhoI-AgeI site of the pAAV using Ligation high Ver.2 (LGK-201; Toyobo: hGFAP(ABC1D) or In-Fusion HD Cloning Kit (Takara Bio, Shiga, Japan: mMBP promoter).
-
bioRxiv - Neuroscience 2020Quote: ... 4 U RNAse inhibitor (Takara, 2313A), 10mM dNTPs (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... D and E using high fidelity PrimeSTAR Max DNA Polymerase (Takara). T7 promoter was introduced upstream of 5’ UTR of SARS-CoV-2 genome in fragment A ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’RACE was carried out using a 5’ Full RACE Core Set (Takara Bio). The first PCR was performed using the single strand cDNAs concatenated by T4 RNA ligase and primers S1 (5’-TTC TAT ACC ATC GTC TAC CCG CTG AGC TTC-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: The 5′ RACE analysis was conducted using the 5′ -Full RACE Core Set (Takara), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.3% Triton X-100 in PBS and then stained with a primary antibody for 48 hours at 4°C with agitation in blocking buffer: DsRed (anti-rabbit, 1:5000, cat. number NC9580775, Takara), GFP (anti-chicken ...
-
bioRxiv - Neuroscience 2021Quote: ... Then the nuclei were centrifuged at 500 x g for 5 minutes at 4°C and washed in 4 ml Nuclei Suspension Buffer (NBS; consisting of 1× PBS, 0.04% BSA and 0.1% RNase inhibitor (Clontech, Cat #2313A)) ...
-
bioRxiv - Genetics 2020Quote: ... The beads were then suspended in TdT reaction buffer (1× NEBuffer #4, 0.25 mM CoCl2, 15 U TdT (Takara Bio), 20 Ci α-32P-dCTP [6000 Ci/mmol]) ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Bioengineering 2022Quote: ... Sections were incubated overnight at 4°C in primary antibody diluted in PBS (1:100 monoclonal mouse anti-GFP; 632380, Clontech). After washing with PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... slides were incubated overnight at 4°C with primary antibody diluted in blocking buffer (these were: 1:200 Living Colors Ab, #632380, Takara; 1:100 L-plastin ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated overnight at 4°C in with primary antibodies Rabbit-anti-dsRed (1:200, Takara Bio Cat# 632496, RRID:AB_10013483) and Chicken-anti-GFP (1:1000 ...
-
bioRxiv - Immunology 2024Quote: ... Retroviral supernatants were then spun for 1 h at 3100g at 4 °C in 12-well-plates coated with 32 mg/ml RetroNectin (Takara). Meanwhile ...
-
bioRxiv - Cell Biology 2022Quote: ... pVSV-G (PT3343-5, Clontech) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and pEco (Takara, #PT3749-5). Cells transduced with the retrovirus were sorted for EGFP positive by flow cytometry ...
-
bioRxiv - Neuroscience 2020Quote: ... and Doxycycline (5 μM, Clontech) on day 4 ...