Labshake search
Citations for Takara Bio :
751 - 800 of 1168 citations for Mouse AWAT2 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech). All PCR-amplified products for both plasmids were sequenced to exclude the possibility of second site mutagenesis ...
-
bioRxiv - Developmental Biology 2019Quote: ... plasmid after digestion of the inserts by EcoRI and KpnI and cloning into the EcoRI and EcoRV sites in frame with the C-terminal Flag tag in pSNAPf plasmid using In-Fusion Kit (Clontech). The human HSF2-YFP was constructed by PCR and cloned into the XhoI and SalI sites in frame with the N-terminal YFP tag in EGFp-C1 plasmid using In-Fusion Kit (Clontech) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Fusion PCR was carried out to create an eYFP marker under the control of the 3xP3 promoter with an SV40 terminator from plasmids eYFP-mem (Clontech), pBac[3×P3-dsRed]CP-Gal4-GFY-SV40 (Lynd and Lycett 2012 ...
-
bioRxiv - Molecular Biology 2019Quote: ... interaction test and plasmid isolation were performed using the Yeast Protocols Handbook and Matchmaker GAL4TM Two-hybrid System 3 & Libraries User Manual (Clontech).
-
bioRxiv - Genetics 2019Quote: ... guide sequence and modified guide scaffold14 with the design enabling two guide cassettes to be inserted into one plasmid by In-Fusion cloning (Takara). Guide sequences were designed using the CRISPOR tool15 and chosen to flank the microdeletion observed in patient PFS ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5′UTR of test genes and EGFP were inserted into pCAG-FLAG-N1 plasmid 48 using In-Fusion HD Cloning Kit (TAKARA).
-
bioRxiv - Developmental Biology 2021Quote: All novel plasmids constructed for this study were based on the pSP Sox1/2/3> plasmid previously described (9) with the open reading frames replaced by PCR amplifications using a proofreading DNA polymerase (Primestar, Takara) and plasmids were assembled from linear PCR products using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... CPER fragments containing WT or mutated or 3’UTRs were amplified from the plasmids using PrimeStar GXL polymerase (Takara, Japan) and gel-purified ...
-
bioRxiv - Biochemistry 2020Quote: ... U-[15N,12C,2H]-labelled REC3 domain was overexpressed in BL21(DE3) cells containing chaperone plasmid pG-KJE8 (TAKARA, 3340) in M9 medium in 2H2O containing 2 g l−1 2H12C glucose (Sigma #552003 ...
-
bioRxiv - Cell Biology 2021Quote: ... dual sgRNA cassettes and plasmid DNA (pDNA) were PCR-amplified and barcoded with sequencing adaptors using ExTaq DNA Polymerase (Clontech) following the same procedure as Supplementary Note 1 in Najm et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... doxycycline-inducible ICAM-1 overexpressing vector was created through the cloning of full-length ICAM1 cDNA into a Tet-On lentiviral plasmid pLVX-Tight-Puro (632162, Clontech). The gene expressing vector and the regulator vector (pLVX-Tet-On Advanced ...
-
bioRxiv - Plant Biology 2021Quote: ... using primers and DNA templates listed in Table S4 were cloned into pLRE::LRE-cYFP plasmid linearized with SpeI-HF and AscI by using the In-Fusion HD Cloning Plus system (Clontech). Transformants in Col-0 background (pLRE::GUS ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... or pBR_NL4-3 92TH014.12 IRES eGFP (R5 tropic) [81] (a kind gift from Frank Kirchhoff, Ulm University, Germany) and VSV-G envelope encoding plasmid (PT3343-5, Clontech). 293T cell supernatants were collected 3 days post-transfection ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... VSV G-pseudotyped HIV-1 using full-length HIV-1 molecular clone pNL4-3 [79] or the R5-tropic pNL4-3 AD8 derivative [80] and VSV-G envelope encoding plasmid (PT3343-5, Clontech); 4 ...
-
bioRxiv - Plant Biology 2020Quote: A reporter plasmid was made by cloning the 76bp AG intron sequence upstream of the lacZ gene in the vector pLacZi (Clontech). The yeast reporter strain was made by integration of the linearized AG intron reporter plasmid into the yeast strain YM4271 ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA library derived from soybean hypocotyl and roots RNA were constructed to pGADT7 plasmid fused with GAL4 activation domain (AD) by Clontech company ...
-
bioRxiv - Neuroscience 2020Quote: ... was verified by co-transformation of the bait (pAS2-1-APP or pAS2-1-AICD) and the prey plasmid (HB-EGF-pACT2) in the yeast strain AH109 (Clontech). First ...
-
bioRxiv - Microbiology 2021Quote: ... and the resulting PCR product gel extracted and inserted into the XhoI/NheI-cut plasmid via In-Fusion Cloning (Takara) to make the donor vector pM2GT-1437000-mNeonGreen-3xHA ...
-
bioRxiv - Neuroscience 2020Quote: ... We constructed the T2A-QF2-9xQUAS-GCaMP6f-3XP3-dsRed donor plasmid (Fig. 2a) using the InFusion HD Kit (Clontech, 638910). To preserve the orco coding sequence ...
-
bioRxiv - Microbiology 2021Quote: ... 214 and 321 were inserted between the XhoI and XbaI restriction sites of the pLew100-eGFPX plasmid using the In-Fusion cloning system (Clontech). The PEPCK gene was also in situ tagged at the N-terminal as described above.
-
bioRxiv - Plant Biology 2021Quote: ... The EVD coding sequence (At5TE20395) was directly amplified from wt Col DNA using primers containing appropriate plasmid homology for In-Fusion Cloning (Clontech) into their respective digested binary vector backbones ...
-
bioRxiv - Cancer Biology 2019Quote: ... This plasmid was used as a template to generate GFP-tagged mutant versions Cdc42ep5GPS-AAA using In-Fusion cloning (Takara). To allow for lentiviral infection and stable expression ...
-
bioRxiv - Cell Biology 2021Quote: ... CTLA-4 was synthesized and cloned into the pCDNA3.1+ plasmid (Sangon Biotech, Shanghai, China) with EcoR I and Hind III restriction enzymes (TaKaRa, Japan) to generate the pCDNA3.1-CTLA-4 plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 million cells were electroporated with 5 µg of plasmids encoding tested lncRNAs or with of the pEGFP-N3 reporter vector (Clontech) as previously described 30 ...
-
bioRxiv - Biochemistry 2022Quote: ... and the linearized plasmid gel-extracted and assembled with PCR-amplified codon-optimized mNeongreen or mScarlet using In-fusion cloning (Takara). To generate pPD95.75-itr- 1p-mNG or pPD95.75-itr-1p-mSc plasmids pPD95.75-mNG plasmid was digested with HindIII and PstI ...
-
bioRxiv - Immunology 2022Quote: ... – PU6-pAzpa was co-transfected with plasmids expressing full-lengths mutant 2B4 TCR and CD3 subunits using Xfect transfection kit (TaKaRa). For incorporating pAzpa into TCR sites ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmids were extracted from all the colonies which grew on QDO/X/A agar plate using Easy Yeast Plasmid Isolation Kit (TaKaRa). PCR was carried out using the extracted plasmids as template ...
-
bioRxiv - Genetics 2022Quote: ... The cassette was inserted into MluI restriction site of the pR26 CAG AsiSI/MluI plasmid (addgene 74286, a kind gift from Ralf Kuehn 48) by infusion cloning (Takara). The coding sequence of TIR1-9myc was separated from the CAG promoter by a loxp-STOP-loxp (LSL ...
-
bioRxiv - Plant Biology 2022Quote: ... Bait and Prey constructs were prepared by restriction enzyme cloning with EcoRI and BamHI inserts into the pGBKT7 and pGADT7 plasmids (Clontech). Bait constructs were transformed into the haploid yeast strain Y2HGold (MATa trp1-901 leu2-3,112 ura3-52 hi3-200 gal4Δ gal80Δ LY2::GAL1UAS-Gal1TATA-Hi3 GAL2UAS-GAL2TATA-Ade2 URA3::MEL1UAS-Mel1TATA AUR1-C MEL1) ...
-
bioRxiv - Cell Biology 2022Quote: pGADT7-TMEM11 and pGBKT7-TMEM11 were generated by cloning the TMEM11 cassette from pGFP-TMEM11 and ligating it into NdeI/BamHI sites of pGADT7 and pGBKT7 plasmids (Takara), respectively ...
-
bioRxiv - Microbiology 2020Quote: ... gene was then PCR amplified and purified then cloned into plasmid pLC29144 using In-Fusion HD Cloning plus kit (Takara). All PCR products and linearized vector were purified (Macherey and Nagel ...
-
bioRxiv - Developmental Biology 2021Quote: ... was constructed by inserting a gBlock encoding sfGFP followed by an SV40 polyA sequence and a FRT-flanked ampicillin cassette in place of EGFP in the pEGFP-C1 plasmid (Clontech). For kcne4 and ndufa4l2a BACs ...
-
bioRxiv - Neuroscience 2020Quote: ... EphA7-FL-HA and EphA7-T1- myc expression plasmids were created by subcloning cDNA corresponding to either isoform into pIRES2-EGFP (Clontech) and inserting epitope tags via polymerase chain reaction with Pfu DNA polymerase (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: ... The PCR fragment was then subcloned into the pCAG::myc-IRES-eGFP expression plasmid (Dimidschstein et al., 2013; Tiberi et al., 2012) by In Fusion cloning (Clontech). DNA fragment of pCAG::myc-tagged CROCCP2-IRES-eGFP was then amplified and cloned into lentiviral plasmid backbone (gift from Cecile Charrier ...
-
bioRxiv - Microbiology 2021Quote: ... P3 and NP from D/660 and D/CN286 were amplified from the respective bidirectional pHW2000 plasmid constructs using CloneAmp Hifi PCR mix (Takara) with the following cycle profile ...
-
bioRxiv - Biophysics 2021Quote: ... The resulting DNA fragments were gel-extracted and cloned individually into the pBADC3 plasmid using InFusion EcoDry cloning kit (TaKaRa). All genes were fused with a C-terminal StrepII-tag for affinity purification.
-
bioRxiv - Molecular Biology 2022Quote: ... These fragments were combined to amplify the full genomic sequence that was cloned into a pENTR/D plasmid by InFusion (Takara) to generate pENTR-gMINU2 ...
-
bioRxiv - Microbiology 2022Quote: ... and McGee_sabB_rev (5’ atcgataagcgaattcttaataagcaaacacataattgagatacacgctataaagc 3’) and cloned into the pDYC40 plasmid that contains a kanamycin resistance cassette 55 via In-Fusion cloning (Takara). This plasmid is designed for complementation at a previously characterized ...
-
bioRxiv - Molecular Biology 2022Quote: ... the GST gene from the pEGKG plasmid (29) was amplified by PCR and inserted immediately upstream of GFPS65T using the In-Fusion HD cloning kit (Takara).
-
bioRxiv - Molecular Biology 2019Quote: ... The N-terminal 3X-FLAG-tagged ThPOK expression plasmid was generated by cloning the ThPOK coding DNA sequence (CDS) in the backbone of pEGFPC-3 (Clontech) plasmid after replacing the CDS of EGFP with 3X-FLAG ...
-
bioRxiv - Pathology 2019Quote: ... and 1-1249 (full-length) were cloned into an EGFPC1 plasmid (N-terminal GFP tag) (Takara Bio, Mountain View, CA). For cleavage site validation experiments ...
-
bioRxiv - Molecular Biology 2019Quote: ... which were then cloned in the appropriate order into a pUC19 plasmid using an In Fusion HD Cloning Kit (Takara). The substrates were amplified using Phusion Polymerase PCR (NEB) ...
-
bioRxiv - Cancer Biology 2019Quote: ... p53-EGFP and p53-DsRed Ex plasmid constructs were generated using the pN1-EGFP and pN1-DsRed Ex vectors (Clontech). All the transfections were performed with Lipofectamine 3000 following the product manual ...
-
bioRxiv - Biochemistry 2019Quote: ... Cells were transiently transfected either with GluK3EM or co-tansfected with Wild type/mutant receptors along with GFP expressing plasmid (2 µg/dish) using Xfect reagent (Clontech). Currents were recorded from medium sized cells expressing a moderate level of fluorescence from either the fused EGFP in case of GluK3EM or co-expressed EGFP and having a capacitance of ∼5-6 pF at 48-60 hours post transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... TRPV4(ΔPR)–myc and TRPV4(ΔAR1-3)–myc were constructed using PCR with template plasmids from Open Biosystems subcloned into pCMV-myc vector (Clontech) at the SalI/XhoI sites ...
-
bioRxiv - Cell Biology 2020Quote: ... Cotransformation with pGBT9 and pGADT7 plasmids was performed by a modification of the lithium acetate procedure as described in the Yeast Protocols Handbook from Clontech. Plasmids expressing GAL4-activation domains and GAL4-DNA-binding domains contain the Leu2 and Trp1 selection markers ...
-
bioRxiv - Genetics 2021Quote: ... The mRFP fused FUST-1 cDNA plasmids were used to generate cDNA only plasmids for splicing reporter rescue by removing the mRFP sequences using In-Fusion (Takara). Splicing reporter of fust-1 exon 5 was prepared by cloning exon 4 to exon 6 into the plasmids provided by Dr ...
-
bioRxiv - Plant Biology 2020Quote: ... DNA fragments of about 1000 bp corresponding to the promoters of the target genes were separately inserted into the pHisi-1 plasmid (Clontech). ONAC127 and ONAC129 were fused to GAL4 transcriptional activation domain (pGAD424) ...
-
bioRxiv - Immunology 2021Quote: ... The retroviral transfer vector was co-transfected with pVSV-G retroviral envelope-expressing plasmid into the GP2-293 cell line (Clontech-TaKaRa) using Lipofectamine 2000 reagent (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Forward (control) and reverse (target) RNA probes were synthesized from plasmids amplified via PCR (Advantage HD Polymerase Kit, Takara Bio) using T7 or SP6 RNA Polymerases (ThermoFisher Scientific ...