Labshake search
Citations for Takara Bio :
651 - 700 of 1168 citations for Mouse AWAT2 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... 20 individual bacterial colonies were separately picked from a dilution plating and miniprepped using Nucleospin Plasmid (Takara Bio), and the extracted plasmids were Sanger sequenced to verify the cloning quality of the library ...
-
bioRxiv - Biochemistry 2020Quote: ... To generate stable HaCaT cell lines inducibly expressing V5-Orai1 and Stim1-BirA we used pLVX plasmids (Takara) that were subcloned to express zeocin and blasticidin resistance genes ...
-
bioRxiv - Biochemistry 2019Quote: ... GST and AOC3/ZAG) was amplified by PCR and cloned into the expression plasmid pLVX-Tight Puro (Clontech), which allows packaging of constructs in a lentiviral format ...
-
bioRxiv - Molecular Biology 2020Quote: ... we inserted the coding sequence between the SalI and BamHI restriction sites of the pAcGFP1-N1 plasmid (Takara). The total RNA was extracted from R ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmid constructions were performed with standard restriction enzyme cloning or In-fusion HD Cloning kit (Takara Bio USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... the cDNA sequence of ERK5 isoforms were cloned into pLVX-Puro plasmid (Clontech Laboratories, Mountain View, CA, USA). Plasmids were sequenced to confirm the presence of correct cDNA sequences at the 3’-end of the CMV promoter (data not shown) ...
-
bioRxiv - Cell Biology 2019Quote: GFP-OPTN pEGFPC2 has been described previously [54] and was subcloned into the pLXIN retroviral packaging plasmid (Clontech) for stable cell line production ...
-
bioRxiv - Molecular Biology 2021Quote: ... a plasmid expressing mCherry under the CMV promoter (pmCherry) was cloned by removing EGFP from pEGFP-C1 (Clontech) with AgeI and BglII and assembling the vector with a synthesized mCherry gene fragment (IDT ...
-
bioRxiv - Biochemistry 2020Quote: Plasmids harboring genes encoding individual PKS modules were either generated in this study via In-Fusion Cloning (Takara), site directed mutagenesis ...
-
bioRxiv - Microbiology 2021Quote: ... the cells were transfected with eukaryotic expression plasmid harbouring FLAG or MYC-tagged FBXO22 using Xfect (TAKARA Bio) transfection reagent according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Microbiology 2020Quote: ... 293T cells were co-transfected with the lentiviral vector plasmid and Lentiviral High Titer Packaging Mix (Takara Bio). The culture supernatants containing lentiviral vectors were used to inoculate target cells ...
-
bioRxiv - Neuroscience 2022Quote: ... This sequence was cloned into the EcoRI-NotI sites of the CRISPRa plasmid using In-Fusion cloning (Takara). All guide sequences and their genomic locations are listed in Supplementary Table S1 and PCR primers used to verify editing are listed in Supplementary Table S2.
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Molecular Biology 2023Quote: ... MaV108 was transformed with a DNA fragment that was amplified by PCR reaction using a plasmid pLexA (Clontech) as a template for HIS3 marker ...
-
bioRxiv - Microbiology 2023Quote: The pEGFP-C1 plasmids including AFF4 3’UTR sites “1-2-3” were generated using pEGFP-C1 (Clontech). The following complementary oligonucleotides were annealed in respective pairs as above (1.25 µM each in 75 mM NaCl ...
-
bioRxiv - Immunology 2023Quote: Wt or mutated human (h)ALPK1 cDNA constructs were cloned into the pCMV-myc plasmid (Takara Bio Inc) and were all siRNA resistant against the hALPK1 siRNA (s37074 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 18-20 μg of indicated plasmids were transfected in HEK293T cells using the CalPhos Mammalian Transfection Kit (Takara). After 48h ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293T/17 cells were co-transfected with 0.8 pmol SINEUP-GFP or miniSINEUP-GFP FRAM (0.8 pmol) and 0.2 pmol sense pEGFP-C2 plasmids (Clontech) in each well of a 6-well culture plate ...
-
bioRxiv - Cell Biology 2023Quote: ... The DCC-GFP D1290N mutant plasmid was generated by point mutation (GAC to AAC oligo CCAACACTCTCAGTGAACCGAGGTTTCGGAG; Infusion, Clontech).
-
bioRxiv - Bioengineering 2023Quote: ... Purified insert DNA was cloned into the linearized modRNAc1 plasmid using the In-Fusion Cloning Kit (Takara Bio). The DNA template for modRNA synthesis was PCR amplified from the successfully cloned modRNAc1 plasmid followed by PCR purification using DNA Clean & Concentrator-5 (Zymo Research) ...
-
bioRxiv - Genetics 2023Quote: ... the miR-34c locus was ligated into the multiple cloning site (MCS) of the pTetOne plasmid (Takara Bio).
-
bioRxiv - Molecular Biology 2024Quote: ... YCplac22 plasmids that carry the cac1-20 mutant allele were constructed using the PrimeSTAR Mutagenesis Basal Kit (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... They were transfected with pAAV, pAAV2/1 (Penn Vector Core, Philadelphia, PA, USA) and pHelper plasmids (Takara Bio)52 ...
-
bioRxiv - Neuroscience 2024Quote: ... The pmEOS2-C1-ERGIC53 plasmid was constructed using using the In-Fusion® Snap Assembly Cloning Kit (Takara) and transformed into OmniMAX competent cells ...
-
bioRxiv - Neuroscience 2022Quote: ... the 99-1820 bp fragment of the Rat Glt-1 plasmid (GenBankTM accession number X67857.1) was subcloned between the EcoRI and Xba restriction sites of pEGFP vector (Clontech). GFP-Rab4 ...
-
bioRxiv - Molecular Biology 2021Quote: 20 cm plates of HEK293T cells were transfected with 10 µg of each plasmid using CalPhos transfection kit (Takara) according to manufacturer’s instructions and harvested 3 days later ...
-
bioRxiv - Cell Biology 2019Quote: ... these sequences were amplified by PCR from plasmids described above and inserted into SmaI-digested pLVX-puro vector (Clontech) by Gibson Assembly ...
-
bioRxiv - Genetics 2019Quote: ... This sequence was cloned into the EcoRI-NotI sites of the modified plasmid 61591 using In-Fusion cloning (Takara). The guide sequence ‘FOP1’ (AAAAGGTGAGGTCACGAGGCC ...
-
bioRxiv - Developmental Biology 2021Quote: ... and as a prey to the activation domain of the GAL4 transcription factor (GAL4-AD) in plasmid pACT2 (Clontech). To monitor the induction of a HIS3 reporter gene by complexes of bait and prey fusion proteins ...
-
bioRxiv - Biochemistry 2020Quote: Mutations were introduced to plasmids coding for PALI1 and its truncations using Takara PrimeSTAR HS DNA Polymerase (Clontech #R045A), with primers indicated in Supplementary Table 2 ...
-
A GID E3 ligase assembly ubiquitinates an Rsp5 E3 adaptor and regulates plasma membrane transportersbioRxiv - Cell Biology 2021Quote: ... pGADCg- and pGBKCg-based plasmids containing the indicated protein fusions were transformed into the yeast strain Y2HGOLD (Takara Bio), and double transformants were selected by growth on SD media lacking leucine and tryptophan ...
-
bioRxiv - Immunology 2021Quote: The cDNA for different FcRs was cloned in fusion with EGFP in the pLVX-CMV-IRES-Puro plasmid (Clontech). The cDNA coding for FcγRI was amplified from the NM_000566 cDNA (Origene ...
-
bioRxiv - Plant Biology 2021Quote: ... The two types of plasmids were co-transformed into yeast strain EGY48 according to the Yeast Protocols Handbook (Clontech) as described previously(Lin et al. ...
-
bioRxiv - Microbiology 2021Quote: ... The regions of the expression plasmids containing the entire inserts were PCR amplified using PrimeSTAR GXL Polymerase (Takara, Japan) and Nanopore_pCMV_F and Nanopore_BGH_R primers (Supplementary table 7) ...
-
bioRxiv - Biophysics 2020Quote: ... 200 ng of pRC-SCN1B (NM_001037) (kind gifts of AL George, Northwestern University, Feinberg School of Medicine) and 1.6 μg pEGFP-N3 plasmid (Clontech). Cells were re-plated onto 35-mm Petri dishes the day after transfection for patch-clamp experiments ...
-
bioRxiv - Bioengineering 2022Quote: HEK293T cells were transfected with given plasmids and then harvested for RNA extraction by NucleoSpin RNA Plus Kit (Takara) 48 hour after transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... Splice sites (SS) mutations were introduced in the corresponding parental plasmid using In-Fusion HD Cloning kit (Takara Bio) to generate pcDNA3.1-RLuc_FOXP3 Intron 7 5’-SS G- U ...
-
bioRxiv - Bioengineering 2022Quote: ... A lentiviral transfer plasmid co-encoding zsGreen with Oatp1b1 was cloned using the In-Fusion HD Cloning kit (Takara Bio USA Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... The yeast was transformed with the indicated plasmids using the Matchmaker™ Yeast Transformation System 2 (Clontech, Cat#: 630439). Two plasmids containing simian virus (SV ...
-
bioRxiv - Neuroscience 2020Quote: SH-SY5Y cells were seeded on the glass bottom plates and transfected with 0.5 μg of Mito dsRED plasmid (Clontech) using lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2021Quote: The s2m sequence or control scrambled sequence of s2m (s2m_scr) was inserted into the 3’ UTR of GFP in H6P plasmid using In-Fusion Cloning kit (TaKaRa) and verified by sequencing ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Microbiology 2022Quote: The plasmids of the SARS-CoV-2 cDNA library as cloned in the pLVX-EF1alpha-IRES-Puro (Takara/Clontech) vector were a kind gift from Prof ...
-
bioRxiv - Systems Biology 2022Quote: ... The DNA regions of interest were amplified from host plasmids by PCR using CloneAmp HiFi PCR Premix (Takara, 639298) with custom primers for Gibson assembly (with overhangs) ...
-
bioRxiv - Cell Biology 2019Quote: ... a pFA6a-3’UTR-AfeI-5’UTR-scd2-kanMX-3’UTR (pSM2255) plasmid was generated by InFusion cloning (Clontech) of a pFA6a-based plasmid containing the yeast kanMX resistance cassette digested with KpnI and AscI ...
-
bioRxiv - Microbiology 2019Quote: A 100 bp fragment of the K8.1 promoter or ORF57 promoter was generated by PCR from the BAC16 genome and cloned into the KpnI and HindIII sites of the pGL4.16 reporter plasmid using Infusion cloning (Clontech). The left origin of replication was similarly generated by PCR from the BAC16 genome and cloned into the NotI and BstXI sites of the K8.1Pr-pGL4.16 plasmid ...
-
bioRxiv - Microbiology 2021Quote: For the generation of a tau-P301S expression plasmid the multiple cloning site (MCS) of the pLHCX vector (Clontech) was modified by inserting a synthetic MCS-sequence (ACCGGTCTCGAGGCGGCCGCGGCCAAAAAGGCCGGATCCGTTAACACCAAAAA ATGGCACGTGGCCGGCACGCGTGGGCCCGTCGAC ...
-
bioRxiv - Plant Biology 2019Quote: ... For Yeast Two-Hybrid assays RIPa was sucloned from the pGEM-T easy vector into pGADT7 plasmid (Clontech Laboratories) using the mentioned restriction sites ...
-
bioRxiv - Immunology 2021Quote: ... The sequence of the HXP-S was inserted into pNDV_LS/L289A rescue plasmid (between P and M genes) by in-Fusion cloning (Clontech). The recombination product was transformed into MAX Efficiency™ Stbl2™ Competent Cells (Thermo Fisher Scientific ...