Labshake search
Citations for Takara Bio :
701 - 750 of 1168 citations for Mouse ATPAF2 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... This plasmid was linearized with BamHI and used to clone VPS13D^EGFP and VPS13D^Halo by Infusion cloning (Takara). An N-terminal fragment of VPS13D ...
-
bioRxiv - Immunology 2020Quote: The VP1 gene plasmid of OMH-02 was doubles digested using EcoR I and Hind III (TaKaRa, Dalian, China). In the control group ...
-
bioRxiv - Cell Biology 2021Quote: ... of PINK1 or OMA1 encoding plasmid using appropriate primers followed by Gibson assembly (In-Fusion HD Cloning system, Clontech) into the SalI-XhoI of the pLenti-CMV-Neo vector ...
-
bioRxiv - Microbiology 2019Quote: ... Purified PCR fragments were inserted into the pHEX2 plasmid (53) using the In-Fusion HD Cloning Plus kit (Clontech). Expression of the transgenes was controlled by the SAG1 promoter and selection was provided by the presence of the HPT selectable marker (50) ...
-
bioRxiv - Microbiology 2020Quote: ... and plasmid backbone fragments were assembled via an In-Fusion® HD Cloning Kit (TAKARA Bio; Kusatsu, Shiga, Japan) to generate the plasmid (oecB- or oecC-pK18-CmR-pheS**) ...
-
bioRxiv - Bioengineering 2021Quote: Plasmids were constructed by standard molecular biology methods such as polymerase chain reaction (PCR) and In-fusion cloning (Clontech). Mutations for specific amino acids were generated by overlap-extension PCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Zfp131 cDNAs were fused to 1x hemagglutinin (HA) tag and cloned into p2lox plasmid using In-fusion (Clontech) cloning ...
-
bioRxiv - Neuroscience 2022Quote: ... This sequence was cloned into the EcoRI-NotI sites of the modified plasmid 61591 using In-Fusion cloning (Takara). The ‘empty vector’ control contained CMV-promoter driven dSaCas9-KRAB but no guide sequences ...
-
bioRxiv - Microbiology 2022Quote: ... using specific primers flanked by 15bp overlapping regions from pL6-var2csa-promoter-deletion plasmid and pUF1_Cas9 (list of primers, see Supplementary Table S8) that allowed the cloning by infusion cloning (Clontech, Takara Bio USA ...
-
bioRxiv - Microbiology 2022Quote: ... PCR amplification from genomic and plasmid DNA templates was performed using PrimeStar Max DNA polymerase (Takara Bio, Kusatsu, Japan) or GoTaq Master Mix (Promega ...
-
bioRxiv - Bioengineering 2023Quote: ... was cloned into the prey vector pPR3-N and co-transformed into yeast strain NMY51 cells together with pDHBⅠ-GhERF105a plasmid according to the Matchmaker user’s manual protocol (Clontech). Yeast transformants were selected by growth on synthetic dropout nutrient medium SD/-Leu/-His/-Ade/-Trp (Clontech ...
-
bioRxiv - Cell Biology 2022Quote: ... Mav203 was transformed with four plasmids and spread onto Sc-LeuTrpUra plates containing 0.5 μg/ml Aureobasidin A (TAKARA).
-
bioRxiv - Microbiology 2022Quote: ... 293T cells were co-transfected with the aforementioned lentiviral vector plasmid and Lentiviral High Titer Packaging Mix (Takara Bio).
-
bioRxiv - Microbiology 2023Quote: ... to ligate the variant insert pool into BsmBI-digested pHW2000 plasmid and transformed Stellar™ Competent Cells (Takara, #636763) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: AAV transfer plasmids were constructed by removing all the sequences between the ITRs of the pAAV-CMV vector (TaKaRa) and inserting the Mhck7 promoter ...
-
bioRxiv - Bioengineering 2023Quote: ... following which these sequences were inserted into the parental plasmid using In-Fusion® cloning kit (Takara Bio Inc.).
-
bioRxiv - Immunology 2023Quote: ... All expression plasmids for transient expression were cloned into the pCS2+ vector backbone and cloned using InFusion HD (Clontech). Constitutive lentiviral expression was performed using pCDH vector constructs (System Biosciences ...
-
bioRxiv - Molecular Biology 2023Quote: Expression plasmids for fusion proteins of GFP and tardigrade proteins were constructed by Gibson assembly into pEGFP-N1 (Clontech) of the tardigrade cDNA (obtained by gene synthesis from Integrated DNA ...
-
bioRxiv - Synthetic Biology 2023Quote: A 10 cm dish of HEK293T cells that had been transfected with the GFP expressing plasmid pEGFP-N1 (Clontech) was washed with PBS and lysed by sonication on ice in PBS supplemented with 0.2 % Triton X100 ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmid DNA used to generate lentiviral particles were transfected into HEK293 cells using LentiX single-shot VSV-G (Takara) following manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli BL21 (DE3) containing a pGro7 plasmid for overexpression of the GroEL/ES chaperone system (Takara Bio, Shiga, Japan). ACP (acyl phosphatase ...
-
bioRxiv - Biophysics 2023Quote: ... All remaining unsorted cells in addition to the sorted cell populations were then miniprepped (Takara NucleoSpin Plasmid miniprep kit), and DNA was stored at 4 °C short-term or at −20 °C for long-term storage.
-
bioRxiv - Biochemistry 2023Quote: The plasmids of TiCGSCy mutants (E1442Q, E1442A and E1356A) were constructed using a PrimeSTAR mutagenesis basal kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: A cDNA fragment encoding human FAM53C was isolated by amplifying with nested PCR from human cDNA library plasmid (Takara). The oligonucleotide primer sequences used for the 1st PCR are 5′-CAAAGTGTGCAAGTCAAATCCTGG-3′ (5′ upstream ...
-
bioRxiv - Microbiology 2024Quote: ... Heparan sulfate sulfotransferase genes (in pDONR223 from the ORFeome v8.1 collection (Dharmacon)) were cloned by LR reaction (ThermoFischer Scientific) into mammalian expression plasmid pDest-eGFP-N1 (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... All the other plasmids used in this study are cloned by following the standard protocol of Infusion HD (Takara).
-
bioRxiv - Developmental Biology 2024Quote: ... 5xmyc-RPGRIP1L cDNA was amplified from the plasmid pCS2-5xmyc-RPGRIP1L (23) using CloneAmp HiFi PCR Premix (Takara # 639298) using primers ...
-
bioRxiv - Cell Biology 2024Quote: ... two PCRs were performed using li-Strep_ss-SBP-EGFP-Ecadherin (a gift plasmid from F. Perez) (Boncompain et al., 2012) and pEGFP-C1 (Clontech) as templates and the following primer pairs (GAT GCA CCC GGG AGG CGC GCC ATG and CTC CTC GCC CTT GCT CAC ACC TGC AGG TGG TTC ACG ...
-
bioRxiv - Plant Biology 2019Quote: ... and detected with a mouse anti-GFP (1:2000; 632569; Takara Bio Inc.) or a mouse anti-tubulin (1:2000 ...
-
bioRxiv - Genetics 2019Quote: ... Antibodies used were GAL4 AD Mouse Monoclonal Antibody (Takara Bio USA, Inc. #630402), GAL4 DNA-BD Mouse Monoclonal Antibody (Takara Bio USA ...
-
bioRxiv - Immunology 2019Quote: ... The cDNA was generated and amplified by SMARTer Mouse TCRαβ Profiling Kit (Clontech). Libraries were sequenced by illumina sequencer MiSeq (2×250 cycles) ...
-
bioRxiv - Immunology 2021Quote: ... Blots were stained with the mouse α-GFP or α-mCherry (Clontech, EU) antibodies.
-
bioRxiv - Neuroscience 2020Quote: Mouse Nwd1 cDNAs were subcloned into the pEGFP-C2 vector (Clontech Takara Bio) to express the Nwd1 protein fused with EGFP ...
-
bioRxiv - Cell Biology 2020Quote: The mouse Tacc3 sequence was amplified by PrimeSTAR® Max DNA polymerase (TAKARA) using forward 5’-CTCCCCAGGGGGATCATGAGTCTGCATGTCTTAAAT-3’ and reverse 5’-GAGGTTGATTGTCGATCAGATCTTCTCCATCTTAG-3’ primers ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Itgb3 was cloned into the pLVX-EF1α-IRES-Puro vector (Takara Bio) per a previously described cloning strategy (Dave et al. ...
-
bioRxiv - Immunology 2022Quote: ... or splenocytes from a naïve C57BL/6 mouse using NucleoSpin RNA Plus (Takara). RNA was reverse transcribed with SuperScript III RT and random primers (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Immunoblots were probed with mouse anti-GFP (1:10,000 JL-8, Clontech #632380) and rabbit anti-β-actin (1:10,000 Cell Signaling #4967 ...
-
bioRxiv - Microbiology 2020Quote: ... A mouse 7-day embryo cDNA Library (CATALOG No. 630478; Clontech Laboratories, Inc.) was used to identify host interaction proteins of Mtb PknG through yeast two-hybrid assay ...
-
bioRxiv - Cell Biology 2022Quote: Every protein expressed in mouse rods was also cloned into pEGFP-N1 (Clontech) for expression in AD293 cells using the AgeI and NotI cloning sites within the vector to replace EGFP with the tagged proteins ...
-
bioRxiv - Neuroscience 2020Quote: Mouse Nwd1 cDNAs were subcloned into the pEGFP-C2 vector (Clontech Takara Bio) to express the Nwd1 protein fused with EGFP ...
-
bioRxiv - Microbiology 2023Quote: ... and mouse GAPDH transcripts as described previously 47 using SYBR green reagent (Takara) with primer pairs 1195/1196 ...
-
bioRxiv - Physiology 2024Quote: ... (Cx43: 1:3000 custom-produced rabbit polyclonal; eGFP: 1:1000 mouse monoclonal (Clontech Laboratories Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... TTAGCTAGCCTTCTGATGTGATAGTTTATC TTCTG-3’ were used to amplify the 3xFLAG-BBS10 from the BBS10 ORF plasmid using CloneAmp HiFi PCR premix (Takara), which was further cloned into the CD520A-GFP plasmid via XbaI and Nhe I restriction sites ...
-
bioRxiv - Genetics 2020Quote: ... Full length wild type NHR-25 was tagged with EGFP at its N-terminus using pEGFP-C2 plasmid vector (Clontech); wild-type and mutant LIR-2s were N-terminally FLAG-tagged using the p3xFLAG-CMV-10 expression vector (SIGMA-Aldrich) ...
-
bioRxiv - Developmental Biology 2021Quote: DN-Brn2 expression vector was generated by PCR amplification of Brn2 DBD and addition of NES sequences using primers ATC ATC GAA TTC GAG AGT CAT GCT TCA ACT TCC TCC TCT TGA ACG CCT TAC CCT TGG AGG AGG AGG ACC GGG CCA CCC AGG CGC GCA C and GAT GAT GGA TCC CCA AGG GTA AGG CGT TCA AGA GGA GGA AGT TGA AGT CCT CCT CCT CCA CCC CCA TAC ACA TCC TCG GC and mBrn2 template plasmid (Sugitani et al. 2002) into mCherry N1 (Clontech). Subsequently ...
-
bioRxiv - Microbiology 2022Quote: ... non-structural genes were PCR amplified in three fragments from the pRepDVRluc plasmid [37] and all fragments were inserted into the PUb-MCS-2A-Puro plasmid [64] using In-Fusion cloning kit (Takara) to generate the PUb-NS(Ø ...
-
bioRxiv - Neuroscience 2021Quote: ... as described previously (Keith et al., 2012, Freund et al., 2016) with plasmids encoding green fluorescent protein (GFP) (pEGFPN1; Clontech), mouse Kif11 (Myers and Baas ...
-
bioRxiv - Genomics 2020Quote: ... The resulting plasmids were digested with Kpn1 and Xho1 at the multiple cloning site of the vector and serially deleted from the XhoI cutting site (5’-protruding end) by treating the plasmids with exonuclease III and mung bean nuclease (Takara) for fixed times ...
-
bioRxiv - Cancer Biology 2019Quote: ... All the amplicons were cloned into a lentiviral plasmid pCSII–CMV–MCS (RIKEN, RDB04377) by using the In-Fusion HD Cloning Kit (TaKaRa), to produce the pCSII– CMV:A3B–3×FLAG–IRES–EGFP donor DNA plasmid.