Labshake search
Citations for Takara Bio :
551 - 600 of 893 citations for M CHERRY MRNA mCherry Fluorescent Protein coding mRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and cDNA was synthesized using the M-MLV Reverse Transcriptase cDNA Synthesis Kit (Takara) following the manufacturer’s instructions ...
-
Deletion or inhibition of PTPRO mitigates diet-induced hepatic steatosis and inflammation in obesitybioRxiv - Immunology 2022Quote: ... Protein concentrations were assessed with the BCA protein assay kit (Takara BCA Protein Assay Kit ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentrations were estimated using a BCA Protein Assay Kit (Takara). For FRAP experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... LNCaP-C4-2 cells were transduced to express ZsGreen or Firefly luciferase-mCherry by the Wake Forest Baptist Comprehensive Cancer Center (WFBCCC) Cell Engineering Shared Resource using a lentivirus (Clontech or Genecopoeia). LNCaP-C4-2 and PC3-mm were sorted into CD117+ and negative populations using the Miltenyi MACS sorting beads or the ThermoFisher MagniSort CD117 (c-kit ...
-
bioRxiv - Developmental Biology 2019Quote: To quantify EEC morphology score, chick anti-GFP (Aves GFP1010, 1:500 dilution) and rabbit anti-mcherry (TAKARA 632496, 1:250 dilution) antibodies were used in the fixed Tg(gata5:lifActin-EGFP);Tg(neurod1:TagRFP ...
-
bioRxiv - Genetics 2021Quote: ... the PC1-CTT (mPC-4119) [6] insert was fused with mCherry and cloned into pcDNA3 using an In-Fusion HD Plus kit (Takara Bio, 638909). The expression plasmids for EGFP-SLK (pEGFP-C1+SKL ...
-
bioRxiv - Microbiology 2021Quote: ... The LAMP1 gene was then sub cloned into the pEF1α-mCherry-N1 vector using the In-Fusion® HD Cloning Kit (Clontech, Takara, Japan), according to manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... Samples were run on SDS-PAGE and analyzed by Western blot using mouse anti-mCherry primary antibody (1:2000, Takara Bio #632543) and Licor secondary antibody (Licor #926032212 ...
-
bioRxiv - Genomics 2022Quote: ... These guides were individually cloned into pAAV-U6-sasgRNA-CMV-mCherry-WPREpA (92) at the BstXI and XhoI restriction enzyme sites using the In-Fusion (Takara Bio, 638910) cloning methods as described in (92) ...
-
bioRxiv - Microbiology 2021Quote: ... The membranes were then incubated with either primary monoclonal antibodies anti-mCherry (Clontech #632543, Takara Bio USA, Inc., Mountain View, CA, USA) or anti-GFP (#CAU20008 ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus control animal brain sections were incubated overnight at room temperature in rabbit anti-DsRed (for detection of mCherry; 1:500; Clontech Laboratories, CA) and anti–dopamine beta hydroxylase (DBH ...
-
bioRxiv - Molecular Biology 2021Quote: ... with AgeI and BglII and assembling the vector with a synthesized mCherry gene fragment (IDT) using In-Fusion cloning (Takara Bio, #102518). pB-Tet-Cas13d was cloned using Gibson assembly by inserting a fragment PCR-amplified from pXR001 containing NLS-RfxCas13d-NLS-HA-T2A-EGFP into a piggyBac transposon vector (Cadiñanos and Bradley ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The C-terminus of Rtl5 was fused with mCherry by means of a cloning enzyme (In-Fusion® HD Cloning Kit, Takara Bio) and it was inserted into a pGEM T Easy vector (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... The C-terminus of Rtl9 was fused to a 4x GGS linker (ggaggatcaggaggatcaggaggatcaggaggatca)-attached mCherry by means of a cloning enzyme (In-Fusion® HD Cloning Kit, Takara Bio). The purified targeting vector was assessed for its quality by Sanger sequencing and injected into mouse pronuclei at the final concentration of 10 ng/μl ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmid pmCherry was generated by fusing the lacI-Ptrc inducible system and mCherry into the vector pBBR1MCS-5 using In-Fusion® Snap Assembly Master Mix (Takara Bio). All plasmids were extracted using QIAprep® Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentration was measured using the BCA Protein Assay Kit (Takara Bio). The protein samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration was determined by a BCA protein assay kit (TakaRa) using bovine serum albumin (BSA ...
-
bioRxiv - Physiology 2022Quote: ... Protein concentration was determined using the BCA protein assay kit (Takara Bio).
-
bioRxiv - Developmental Biology 2019Quote: ... The first strand cDNA was generated with M-MLV first strand cDNA synthesis kit (Takara), using oligo (dT ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 µg of total RNA was converted to cDNA using M-MLV reverse transcriptase (TAKARA) under standard conditions with oligo(dT ...
-
bioRxiv - Genomics 2023Quote: The nuclei containing about 1,000 ng of DNA were resuspended with 1x M buffer (Takara). To permeabilize nuclei ...
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Lc3b and GFP-Lc3b were made by cloning Lc3b into the EcoRI and BamHI sites of pEGFP-C1 (Clontech Laboratories, CA, USA). GST-Lc3b was constructed by cloning Lc3b into the BamHI and SalI sites of pGEX-4T-1 (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... The LAMP1 gene was then sub cloned into the pEF1α-mCherry-N1 vector using the In-Fusion® HD Cloning Kit (Clontech, Takara, Japan), according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... coding sequences were amplified by PCR from zebrafish cDNA using specific primers (Table S1) and subcloned into mCherry-C1 vector (Clontech, Mountain View, CA). hVPS4A in pEGFP-C1 was previously described in Elia et ...
-
bioRxiv - Neuroscience 2023Quote: ... LRP10 sequence-verified cDNA was subcloned from the pcDNA™3.1-LRP10-V5-His-TOPO® plasmid described previously (9) into the pLVX-EF1α-IRES-mCherry plasmid (Takara Bio, 631987). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... LRP10 sequence-verified cDNA was subcloned from the pcDNA™3.1-LRP10-V5-His-TOPO® plasmid (Quadri et al., 2018) into the pLVX-EF1α-IRES-mCherry plasmid (Takara Bio, 631987) via Gibson Assembly® (NEB ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Protein concentrations were measured with a BCA protein assay kit (Takara, Dalian, China).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was quantified using the BCA protein assay kit (Takara Bio, T9300A). Cell lysates (about 200 µl ...
-
bioRxiv - Microbiology 2023Quote: ... Fluorescent signals from resulting PCR products were acquired using a Thermal Cycler Dice Real Time System III (Takara). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... Fluorescent signals from resulting PCR products were acquired using a Thermal Cycler Dice Real Time System III (Takara).
-
bioRxiv - Cell Biology 2021Quote: ... and purified under denaturing condition (8 M urea) using the TALON metal affinity resin from Clontech. Purified fusion proteins were used to produce antibodies in guinea pigs from Covance Inc ...
-
bioRxiv - Molecular Biology 2022Quote: ... EBIV M/L segment-specific sequences were amplified by PCR including Universal Primer A Mix (Takara), Gene-Specific Primers (GSPs ...
-
bioRxiv - Plant Biology 2021Quote: ... The fused proteins were purified with the GST-tagged protein purification kit (Clontech, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... The protein concentration was determined using the BCA protein assay kit (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein concentration was quantified using the TaKaRa BCA Protein Assay Kit (TaKaRa, Japan), and 2-mercaptoethanol (Nacalai Tesque ...
-
bioRxiv - Developmental Biology 2021Quote: ... and recombinant Cas9 proteins (Clontech) were introduced together into the KhES-1 cells by electroporation (Neon device ...
-
bioRxiv - Molecular Biology 2023Quote: ... The recombinant Cas9 protein (TAKARA) and the sgRNA were incubated for 10 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... and fluorescent signals from resulting PCR products were acquired using a Thermal Cycler Dice Real Time System III (Takara). Finally ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNAs were synthesized from total RNA using Moloney Murine Leukemia Virus (M-MLV) Reverse Transcriptase (Takara, Japan) based on the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... the plug was incubated in 160 μL of 1× M buffer containing 160 units of NheI (TaKaRa) overnight at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein purity and concentration were determined by SDS-PAGE and BCA protein assay kit (Takara) respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... Total protein was quantified using the TAKARA BCA Protein Assay Kit (TAKARA Bio Inc., Japan). Equal amounts of protein were separated by SDS-PAGE on 10% gels ...
-
bioRxiv - Microbiology 2023Quote: ... The amplified fragments were then fused with SmaI-linearized pisCIIA-mCherry (Mamun et al, 2020) using the In-Fusion HD Cloning Kit (Clontech Laboratories, Mountain View, CA, USA). Recombinant plasmids for the expression of mCherry-fused 19 proteins were digested with NotI and ectopically inserted into the ATP sulfurylase (sC ...
-
bioRxiv - Microbiology 2023Quote: ... genomic DNA using the indicated primers (Table S1).Fluorescent reporters were ordered as gBlocks and cloned using the In-fusion HD EcoDry Cloning kit (Takara). Promoter reporter constructs were created as previously described (11 ...
-
bioRxiv - Immunology 2021Quote: ... and the protein concentration was measured by BCA protein assay kit (TaKaRa, Dalian, China, cat#T9300A) as previous described(Ma et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protein concentration was found to be 0.9 µg/µl using BCA Protein Assay Kit (TaKaRa).
-
bioRxiv - Microbiology 2022Quote: Protein-protein interactions were assayed with the Matchmaker yeast two-hybrid system (Clontech, Mountain View, CA). ORFs of AoHse was amplified from first-strand cDNA of A ...
-
bioRxiv - Physiology 2022Quote: ... Obtained luminescence was normalized to total protein concentration measured by BCA protein assay kit (Takara Bio).
-
bioRxiv - Microbiology 2024Quote: Protein concentrations were determined using the BCA method (TaKaRa BCA Protein Assay Kit; Takara, Shiga, Japan) after 1% SDS was added to solubilize the samples ...